Number of sequences: 1354
Consensus c/g c/g/a g/c c/g/t c/g/a c/g/a g/c/a c/g/t c/g/t g/c/a c/g c/a/g a/g c/a c/g a t g g/a c/a g/c/t g/c/a c/a/t c/g g/c/a c/a/t/g a 19 22 19 19 21 22 21 18 18 21 16 23 51 30 18 99 0 0 23 28 15 22 28 16 25 26 c 32 32 30 30 32 31 27 32 31 22 34 42 8 40 47 0 0 0 13 38 24 27 31 33 26 27 g 29 26 32 29 27 27 34 27 28 39 29 23 34 16 26 0 0 99 47 18 37 34 17 31 31 20 t 19 18 18 21 18 18 16 21 21 16 19 10 4 12 8 0 99 0 15 14 23 16 22 19 16 24 agcggcggcgggaagatgaggcttcg U10474 Human clone GTN6 beta-1,4-galactosyltransferase mRNA, partial cds. acagcagttccaaccctggaatcaac U10485 Human lymphoid-restricted membrane protein (Jaw1) mRNA, complete tttctggactcaacgatgactctgaa U10550 Human Gem GTPase (gem) mRNA, complete cds. catcggggtgggggcatggaatccgc U10554 Homo sapiens vesicular acetylcholine transporter gene, complete gtccccagggccgcgatgagcttcct U10564 Human CDK tyrosine 15-kinase WEE1Hu (Wee1Hu) mRNA, complete cds. gtagacagatacaagatgaaatcctg Z92846 Human DNA sequence from clone LL0XNC01-105G4 on chromosome X ctgatcagagtcatcatgcctcgagc U10685 Human MAGE-10 antigen (MAGE10) gene, complete cds. ctaaccagagtcatcatgcctcttga U10686 Human MAGE-11 antigen (MAGE11) gene, complete cds. ctgaccagagtcatcatgtcttctga U10687 Human MAGE-4a antigen (MAGE4a) gene, complete cds. ctgagcagagtcatcatgtcttctga U10688 Human MAGE-4b antigen (MAGE4b) gene, complete cds. gtgaccagagtcgtcatgtctcttga U10689 Human MAGE-5a antigen (MAGE5a) gene, complete cds. gtgaccagagtcgtcatgtctcttga U10690 Human MAGE-5b antigen (MAGE5b) gene, complete cds. ctgaccagagtcatcatgcctcttga U10691 Human MAGE-6 antigen (MAGE6) gene, complete cds. ggcgtccttgttccaatgggaaggtg U10692 Human MAGE-7 antigen (MAGE7) pseudogene, complete cds. ctgacctgagtcatcatgcttcttgg U10693 Human MAGE-8 antigen (MAGE8) gene, complete cds. ctgaccagagtcatcatgtctctcga U10694 Human MAGE-9 antigen (MAGE9) gene, complete cds. ccggccctggccccgatggctctgtg U10860 Human guanosine 5'-monophosphate synthase mRNA, complete cds. tggcagagcctcaggatggaccccct U10868 Human aldehyde dehydrogenase ALDH7 mRNA, complete cds. cagggcgcgcggggcatgaagccggc U10886 Human density enhanced phosphatase-1 mRNA, complete cds. ccagaatccgtgaacatggcgaacga U10902 Human alcohol dehydrogenase 5 (ADH5) gene, 5' region and exon 1, ccggaatctccagggatgaccagccc U10990 Human nuclear receptor hTAK1 (hTAK1) mRNA, complete cds. gacaccccggccagaatggagctgac U11025 Human megakaryocyte growth and development factor (MGDF) mRNA, ggcgactggccggccatgccttcccg U11050 Human NIMA-like protein kinase 1 (NLK1) mRNA, complete cds. gtccacgagcccaagatggatgcgct U11058 Homo sapiens large conductance calcium- and voltage-dependent tggattggagacaagatgggatcctc U11090 Human hydroxyindole-O-methyltransferase promoter A-derived (HIOMT) tggattggagacaagatgggatcctc U11091 Human hydroxyindole-O-methyltransferase promoter B-derived (HIOMT) ggaagattagcggccatgtattccaa U11270 Human antithrombin III gene, exon 1 and partial cds. cagggctccggagccatgtggcccaa U11271 Human alternatively spliced endothelial thromboxane A2 receptor cttcctctgtctgccatggaccaaca U11276 Human hNKR-P1a protein (NKR-P1A) mRNA, complete cds. cctgggagactgtggatgaataatgc U11282 Human alpha(1,3)fucosyltransferase mRNA, complete cds. gtcgacgagttgaagatgaagcccag U11287 Human N-methyl-D-aspartate receptor subunit NR3 (hNR3) mRNA, cggcccggcccggccatggcctcgtt U11292 Homo sapiens Ki nuclear autoantigen mRNA, complete cds. acagctggacgggcaatggcgggtcg U11293 Human Rab5c-like protein mRNA, complete cds. ggtgtctatgaaactatggatggtac U11424 Human thiopurine methyltransferase processed pseudogene cacaccgacggtaccatgaaggacga U11552 Human leukotriene-C4 synthase mRNA, complete cds. gcccaggcccggaccatgcatggcca U11690 Human faciogenital dysplasia (FGD1) mRNA, complete cds. tgtccgtgcgggacgatgcctgagca U11700 Human copper transporting ATPase mRNA, complete cds. ccgcgtcccgccgcgatgctgttcca U11701 Human LIM-homeobox domain protein (hLH-2) mRNA, complete cds. ggcagcagtcttagaatgagtagcaa U11717 Human calcium activated potassium channel (hslo) mRNA, complete ctctcgctgtgagacatgtctgagac U11732 Human ets-like gene (tel) mRNA, complete cds. ggtcacgattccataatgtaccacaa U11791 Human cyclin H mRNA, complete cds. attggtaccgtaaccatggtcagctg U11814 Human soluble keratinocyte growth factor receptor mRNA, gactcaccagctgccatgcagcagcc U11821 Human Fas ligand (FasL) mRNA, complete cds. atctgtggaaggagaatgcctaaagt U11861 Human G10 homolog (edg-2) mRNA, complete cds. gccgtggagcgagagatgccggccct U11862 Human clone HP-DAO1 diamine oxidase, copper/topa quinone-containing gccgtggagcgagagatgccggccct U11863 Human clone HP-DAO2 diamine oxidase, copper/topa quinone containing gaaactgaagaggacatgtcaaatat U11870 Human interleukin-8 receptor type A (IL8RBA) gene, promoter and gaaactgaagaggacatgtcaaatat U11871 Human interleukin-8 receptor type A (IL8RA) mRNA, partial cds. aagtttacctcaaaaatggaagattt U11872 Human interleukin-8 receptor type B (IL8RB) mRNA, splice variant aagtttacctcaaaaatggaagattt U11873 Human interleukin-8 receptor type B (IL8RB) mRNA, splice variant aagtttacctcaaaaatggaagattt U11874 Human interleukin-8 receptor type B (IL8RB) mRNA, splice variant aagtttacctcaaaaatggaagattt U11875 Human interleukin-8 receptor type B (IL8RB) mRNA, splice variant aagtttacctcaaaaatggaagattt U11876 Human interleukin-8 receptor type B (IL8RB) mRNA, splice variant aagtttacctcaaaaatggaagattt U11877 Human interleukin-8 receptor type B (IL8RB) mRNA, splice variant aagtttacctcaaaaatggaagattt U11878 Human interleukin-8 receptor type B (IL8RB) mRNA, splice variant tctttctggggtaatatgcacgtgtc U12128 Human protein tyrosine phosphatase 1E (PTP1E) mRNA, complete cds. tcaaccagaatcaagatgtctgggac U12134 Human DNA damage repair and recombination protein RAD52 mRNA, cactggctgctagggatgtcgtcctg U12140 Human tyrosine kinase receptor p145TRK-B (TRK-B) mRNA, complete acaagcgagaggatcatggcggatgg U12170 Human zinc finger homeodomain protein mRNA, complete cds. agatagatcgccatcatggtgagtct U12202 Human ribosomal protein S24 (rps24) gene, complete cds. cacttgccaacatagatggaaccggc U12206 Human clone pL713 hypothetical protein mRNA, partial cds. ggtcgtcctctcagcatgggggtccc U12255 Human IgG Fc receptor hFcRn mRNA, complete cds. ggtgtctctgaaactatggatggtac U12387 Human thiopurine methyltransferase (TPMT) mRNA, complete cds. gcggcgtgagaagccatgagcagcaa U12404 Human Csa-19 mRNA, complete cds. gcagctgcagcagccatggccccgcc U12421 Human mitochondrial benzodiazepine receptor (MBR) gene, complete atctcaggctaagaaatggcatttca U12424 Human mitochondrial glycerol-3-phosphate dehydrogenase mRNA, aaggtaattgctgccatggaaacaca U12431 Human ELAV-like neuronal protein 1 (hel-N1) mRNA, complete cds. gcggcttgtgcagcaatggccaagat U12465 Human ribosomal protein L35 mRNA, complete cds. gcagtcttcgccaccagtgagtacgc U12472 Human glutathione S-transferase (GST phi) gene, complete cds. tccccagcagaagcgatgggcagtgt U12507 Human cardiac inward rectifier potassium channel (HH-IRK1) mRNA, caagtgaaagacacaatgaatggtca U12535 Human epidermal growth factor receptor kinase substrate (Eps8) ttgctttttccagccatgaatgcttc U12541 Human ROM-K potassium channel protein isoform romk1 mRNA, complete gtgttgacagaaagtatgttcaaaca U12542 Human ROM-K potassium channel protein isoform romk2 mRNA, complete gctctataccagtgaatgccaactgt U12543 Human ROM-K potassium channel protein isoform romk3 mRNA, complete gtgttgacagaaagtatgttcaaaca U12544 Human ROM-K potassium channel protein isoform romk4 mRNA, partial gtgttgacagaaagtatgttcaaaca U12545 Human ROM-K potassium channel protein isoform romk5 mRNA, partial ccggccgtcagtaccatggacagcag U12569 Human mu opioid receptor variant (MOR1) mRNA, complete cds. ccaccattgaaagccatgaattttga U12590 Human HOXB2 gene, promoter region. caagatgaactggtgatgctcgtgga U12596 Human tumor necrosis factor type 1 receptor associated protein ggggtcacagctctcatggctgcagc U12597 Human tumor necrosis factor type 2 receptor associated protein agggcagaaagcaccatgagtggggg U12707 Human Wiskott-Aldrich syndrome protein (WASP) mRNA, complete cds. gctctcttgaccactatgagcctcct U12709 Human neutrophil-activating ENA-78 prepeptide gene, complete cds. tacaccaagctgaccatggaccttgg U12767 Human mitogen induced nuclear orphan receptor (MINOR) mRNA, attcctgcgccgaggatggagggcct U12778 Human acyl-CoA dehydrogenase mRNA, complete cds. gcgtccccgggcaccatgctgtccaa U12779 Human MAP kinase activated protein kinase 2 mRNA, complete cds. gaccgagaccgcttcatggatgagtt U12918 Human syntaxin mRNA, complete cds. aagccagaggaaaaaccagaaaaaaa U12969 Human endogenous retroviral element clone pCRTK6 nucleocapsid aaaccagaagaaaaaccagaagagaa U12970 Human endogenous retroviral element clone pCRTK1 nucleocapsid agctggagtctgaagatggagaccaa U12978 Homo sapiens BS-84 (HSD-1) mRNA, complete cds. ttgggagtgtgtggcatgcatcctca U13022 Human negative regulator of programmed cell death ICH-1S (Ich-1) tgaaatactccagccatgactaaaag U13044 Human nuclear respiratory factor-2 subunit alpha mRNA, complete ccgaagcttttccagatgtccctggt U13045 Human nuclear respiratory factor-2 subunit beta 1 mRNA, complete ccgaagcttttccagatgtccctggt U13046 Human nuclear respiratory factor-2 subunit beta 2 mRNA, complete ccgaagcttttccagatgtccctggt U13047 Human nuclear respiratory factor-2 subunit gamma 1 mRNA, complete ccgaagcttttccagatgtccctggt U13048 Human nuclear respiratory factor-2 subunit gamma 2 mRNA, complete ctgggagccgccgccatgggaatgtc U13173 Human intestinal H+/peptide cotransporter (Hpept1) gene, complete cacctcgaagccaacatgaaggagac U13214 Human protaglandin receptor EP3F mRNA, complete cds. cacctcgaagccaacatgaaggagac U13215 Human protaglandin receptor EP3E mRNA, complete cds. cacctcgaagccaacatgaaggagac U13216 Human protaglandin receptor EP3A1 mRNA, complete cds. cacctcgaagccaacatgaaggagac U13217 Human protaglandin receptor EP3D mRNA, complete cds. cacctcgaagccaacatgaaggagac U13218 Human protaglandin receptor EP3A mRNA, complete cds. ggaggcggcgcggccatggaccccgc U13219 Human forkhead protein FREAC-1 mRNA, complete cds. gctcccgggtcccagatgaccaccga U13220 Homo sapiens forkhead protein FREAC-2 mRNA, complete cds. gctctctcgggcaacatggcgggtgt U13261 Homo sapiens eIF-2-associated p67 homolog mRNA, complete cds. cgcttcattagcacttaccatgcctt U13369 Human ribosomal DNA complete repeating unit. ttggcctgcaggaacatggcaagggc U13395 Human oxidoreductase (HHCMA56) mRNA, complete cds. ctttttaaatgcattatggctcatgc U13616 Human ankyrin G (ANK-3) mRNA, complete cds. gcggctggccagaggatgagactccc U13660 Human cartilage-derived morphogenetic protein 1 (CDMP-1) mRNA, atttccatcagcaggatgtgggggct U13665 Human cathepsin O (CTSO) mRNA, complete cds. ccatttagcaaggtcatggaagattt U13666 L35539 Human G protein-coupled receptor (GPR1) gene, complete cds. tctcctgcaggtaccatgatgtgggg U13668 L35538 Human G protein-coupled receptor (GPR3) gene, partial cds. gcatttgttctccaaatgtcaactgt U13680 Human lactate dehydrogenase-C (LDH-C) mRNA, complete cds. ctgttaaaagcgaaaatgaaacaatt U13695 Human homolog of yeast mutL (hPMS1) gene, complete cds. tcgggtgttgcatccatggagcgagc U13696 Human homolog of yeast mutL (hPMS2) gene, complete cds. caactccaaactaacatggcagtcag U13706 Human ELAV-like neuronal protein 1 isoform Hel-N2 (Hel-N1) mRNA, ttaataaaggtatccatggagaacac U13737 Human cysteine protease CPP32 isoform alpha mRNA, complete cds. ttaataaaggtatccatggagaacac U13738 Human cysteine protease CPP32 isoform beta mRNA, complete cds. tgattctggagaaaaatgccggtccg U13896 Human homolog of Drosophila discs large protein, isoform 2 (hdlg-2) tgattctggagaaaaatgccggtccg U13897 Human homolog of Drosophila discs large protein, isoform 1 (hdlg-1) tgcccgttgctagctatggcaaatgg U13913 Human large-conductance calcium-activated potassium channel (hSlo) agcggcaaagcccgaatggtctctag U13948 Human zinc finger/leucine zipper protein (AF10) mRNA, complete cds. gaacgtgcgggcaccatgcgtcccca U13989 Human secretin receptor mRNA, complete cds. tctcccaccggcccgatgagctgcag U13991 Human TATA-binding protein associated factor 30 kDa subunit acgcgaacagggaccatgcagggcaa U14108 Human Mel-1a melatonin receptor mRNA, complete cds. gcggcggctccggggatggcggcggc U14187 Homo sapiens LERK-3 (EPLG3) mRNA, complete cds. cggacctcgggggcgatgcggctgct U14188 Homo sapiens LERK-4 (EPLG4) mRNA, complete cds. tcttcctcctaagccatggcatatca U14193 Homo sapiens transcription factor IIA small 12 kDa subunit (GTF2A2) gcggcgcgagtcaccatgggaagcaa U14391 Human myosin-IC mRNA, complete cds. gcggcagcagcggcaatgaccccttg U14394 Human tissue inhibitor of metalloproteinases-3 mRNA, complete cds. ccgtggctttgagtaatgagaatttc U14407 Human interleukin 15 (IL15) mRNA, complete cds. ccctgggccacgccgatgactactgc U14510 Human transcription factor NFATx mRNA, complete cds. cctctgcggcgtgtcatgggcccgcg U14518 Human centromere protein-A (CENP-A) mRNA, complete cds. catctatctccagaaatgtcttcaga U14528 Human sulfate transporter (DTD) mRNA, complete cds. gcgggccggggctgtatggggctccc U14550 Human sialyltransferase SThM (sthm) mRNA, complete cds. ggtcgattcaggaacatggtgcaaac U14575 Human (ard-1) mRNA, complete cds. gaaaaggtcaaggccatggaagagaa U14577 Human microtubule-associated protein 1A (MAP1A) mRNA, complete cds. tgcagagatttcatcatggtctccca U14580 Human coagulation factor VII gene, promoter region and partial cds. gcccgtggtccggccatggacgacct U14588 Human paxillin mRNA, complete cds. tttttatttgccataatgaaccgtcc U14603 Human protein-tyrosine phosphatase (HU-PP-1) mRNA, partial gcccgctgggccgccatggagcgctg U14631 Human 11 beta-hydroxysteroid dehydrogenase type II mRNA, complete cgtggtagccccaggatgggtgagtt U14650 Human platelet-endothelial tetraspan antigen 3 mRNA, complete cds. ttggaacagaaagaaatggatttatc U14680 Homo sapiens breast and ovarian cancer susceptibility (BRCA1) mRNA, cgctgtaactgcaggatggggaagca U14747 Human visinin-like peptide 1 homolog mRNA, complete cds. accaaaccaaagaccatggttcactg U14755 Human LIM domain transcription factor LIM-1 (hLIM-1) mRNA, complete tgagggagagtgaggatggcagagac U14910 Human RPE-retinal G protein-coupled receptor (rgr) mRNA, complete gggggcgccgggactatgtcgcgggc U14939 Human folylpolyglutamate synthetase gene, partial cds. acataggaggcggccatggcgacccc U14957 Homo sapiens type II phosphatidylinositol-4-phosphate 5-kinase 53K gtctctgttccgcagatggggtttgt U14966 Human ribosomal protein L5 mRNA, complete cds. cagtaattcgccaaaatgacgaacac U14967 Human ribosomal protein L21 mRNA, complete cds. gtctgggctgccaacatgccatccag U14968 Human ribosomal protein L27a mRNA, complete cds. gagggagccgccgccatgtctgcgca U14969 Human ribosomal protein L28 mRNA, complete cds. ggctgtgttctcaggatgaccgagtg U14970 Human ribosomal protein S5 mRNA, complete cds. ggaagcggacgcaacatgccagtggc U14971 Human ribosomal protein S9 mRNA, complete cds. cctgcagccgcagagatgttgatgcc U14972 Human ribosomal protein S10 mRNA, complete cds. actgctgagagcaagatgggtcacca U14973 Human ribosomal protein S29 mRNA, complete cds. agcgtagtgaccatcatgagcctcct U15008 Human SnRNP core protein Sm D2 mRNA, complete cds. tctcttcctgccaagatgtctattgg U15009 Human SnRNP core protein Sm D3 mRNA, complete cds. tttacagagcagagcatgatcacatt U15085 Human HLA-DMB mRNA, complete cds. ccggccctggagaccatgaggttccg U15128 L36537 Human beta-1,2-N-acetylglucosaminyltransferase II (MGAT2) gene, ttgcagagagccgaaatgaccatgac U15131 Human p126 (ST5) mRNA, complete cds. gaatccaggctgaggatggaaggtgt U15173 Homo sapiens BCL2/adenovirus E1B 19kD-interacting protein 2 (BNIP2) ttgccctctggcgccatgtccgagaa U15174 Homo sapiens BCL2/adenovirus E1B 19kD-interacting protein 3 (BNIP3) agaggagatggaaacatgcagagaga U15177 Human cosmid CRI-JC2015 at D10S289 in 10sp13. accagacgcggagccatggccgaggt U15198 Human histo-blood group ABO protein gene, partial cds. caaacgtggcctcctatggacaccca U15422 Human protamine 1 (PRM1), protamine 2 (PRM2) and transition protein cggaagatttcagccatgcctcacag U15460 Human bZip protein B-ATF mRNA, complete cds. gagggagccggaaagatggtggttac U15552 Human acidic 82 kDa protein mRNA, complete cds. gtttttgccttcactatggcaaaaat U15590 Homo sapiens heat shock 17kD protein 3 (HSPB3) mRNA, complete cds. ctcctctttcctaaaatggagtcgag U15637 Homo sapiens CD40 binding protein (CD40BP) mRNA, complete cds. cggcgggcgggcgcgatggcggaggc U15641 Human transcription factor E2F-4 mRNA, complete cds. ccgggacgcgacgcgatggcggcggc U15642 Human transcription factor E2F-5 mRNA, complete cds. cccgggccccccagcatgaagacccc U15655 Human ets domain protein ERF mRNA, complete cds. ttgcagagagccgaaatgaccatgac U15780 Human p82 (ST5) mRNA, alternatively spliced, complete cds. taatcagctgaggccatgtcaggaga U15782 Human cleavage stimulation factor 77kDa subunit mRNA, complete cds. ggcggcggcggcggcatgaaggtcac U15932 Human dual-specificity protein phosphatase mRNA, complete cds. cgtggcctgagcaggatggtgccctc U15939 Human placental folate transporter (hFOLT1) mRNA, complete cds. cccggccgcccagagatgaccgcgac U15979 Human (dlk) mRNA, complete cds. cccggccgcccagagatgaccgcgac U15981 Human (dlk) mRNA, alternatively spliced, complete cds. ccccacaacatgcgtgtcccaggctg U16020 Human Na+/H+ exchanger NHE3 related pseudogene and ALU-like gagtaaggggtcccaatgtctacagc U16028 Human CRE-BP1 transcription factor mRNA, complete cds. tccaagtcccagatcatgtctctgtg U16031 Human transcription factor IL-4 Stat mRNA, complete cds. aaacaaagcaaggagatggccaccaa U16120 Human placental taurine transporter mRNA, complete cds. cggcggcgcccaacgatgaccgctcc U16127 Human glutamate/kainate receptor subunit (EAA5) mRNA, complete cds. ggcgagggcggcgcgatgaaggcggt U16153 Human Id-4H protein mRNA, complete cds. ggagagctgaatgagatgaggacccg U16258 Human I kappa BR mRNA, complete cds. acacgagactgagagatgaattttca U16261 Human MDA-7 (mda-7) mRNA, complete cds. cggaactcgggcatcatggcctcaga U16267 Human AMP deaminase isoform L, alternatively spliced (AMPD2) mRNA, ggttgcctagacaacatgagaaatcg U16268 Human AMP deaminase isoform L, alternatively spliced (AMPD2) mRNA, cgagcgagcccgaggatgggagggca U16273 Human corticotropin releasing hormone receptor variant mRNA, taagaccataaaaccatgggaaacgc U16296 Human T-lymphoma invasion and metastasis inducing TIAM1 protein ccttccaaggccaagatgttcataaa U16306 Human chondroitin sulfate proteoglycan versican V0 splice-variant gctacaatagcctggatggtttcttt U16307 Homo sapiens glioma pathogenesis-related protein (GliPR) mRNA, gaccccgcggccaccatgtatgtggg U16360 Human caudal-type homeobox protein (CDX1) gene, partial cds. acgaaggcggcggcgatggcggcggg U16660 Homo sapiens peroxisomal enoyl-CoA hydratase-like protein (HPXEL) cttgcaaaagaaggcatgcacagctc U16720 Human interleukin 10 (IL10) gene, complete cds. ccgcccgcccgcgccatgaacgccaa U16752 Human cytokine SDF-1-beta mRNA, complete cds. tgacccgccatcgccatggcccgcgg U16799 Human Na,K-ATPase beta-1 subunit mRNA, complete cds. actgagacctgaaaaatggcttcggg U16811 Human Bak mRNA, complete cds. actgagacctgaaaaatggcttcggg U16812 Human Bak-2 gene, complete cds. actgagacctgaaaaatggcatcggg U16813 Human Bak-3 pseudogene, complete cds. cggagtgggccagagatggcggcggc U16815 Human excision repair-controlling (XPAC) gene, complete cds. acaagggccacagccatgaatggcac U16824 Human rhodopsin (RHO) gene, promoter region and exon 1, partial acgagtttcagaacgatggagagctc U16826 Human cocaine and amphetamine regulated transcript CART (hCART) tccccagcagaagcaatgggcagtgt U16861 Human inward rectifying potassium channel mRNA, complete cds. ttgggtttttgaaacatgcatctgta U16953 Human potassium channel beta3 subunit mRNA, complete cds. tgataacaggaagctatgagggaccc U16954 Human (AF1q) mRNA, complete cds. tgctgacatttcaatatgaagggcaa U16957 Human angiotensin II type 2 receptor mRNA, complete cds. ggcggcggcggcggcatgaaggtcac U16996 Human protein tyrosine phosphatase mRNA, complete cds. caagggagctgccccatggacagggc U16997 Human orphan receptor ROR gamma mRNA, complete cds. ggtgatagaggaaacatggccgagta U17031 Human enoyl-CoA hydratase: 3-hydroxyacyl-CoA dehydrogenase gene, catgagaagagagttatgatggcaaa U17032 Human p190-B (p190-B) mRNA, complete cds. gcccagtggttagcgatgctgctgtc U17033 Human 180 kDa transmembrane PLA2 receptor mRNA, complete cds. gcccagtggttagcgatgctgctgtc U17034 Human soluble PLA2 receptor mRNA, complete cds. gagagctgtgtcaccatgtgggtccc U17040 Human prostate specific antigen precursor mRNA, complete cds. gacaccccggccagaatggagctgac U17071 Human megakaryocyte growth and development factor precursor (MGDF) tcaggaccctaaagaatggccgagcc U17074 Human CDK6 inhibitor p18 mRNA, complete cds. tctgggggctgcggaatgcgcgagga U17075 Human p14-CDK inhibitor mRNA, complete cds. tagcccagcatcactatggtggacgc U17081 Human fatty acid binding protein (FABP3) gene, complete cds. ggccgcggggaggacatggccgcgca U17084 U09106 Human neurofibromin (NF1) gene, promoter region and partial cds. gagctcatgcgcagtatgtgtggttg U17179 Human prohibitin gene, exon 1, promoter region, and partial cds. acgtcaggagccaagatggcggcggt U17248 Human succinate dehydrogenase iron-protein subunit (sdhB) gene, gaagccaacgggcggatggttattcc U17278 Human collapsin response mediator protein CRMP-1 mRNA, complete tttcccaggagagagatgtcttatca U17279 Human collapsin response mediator protein hCRMP-2 mRNA, complete atttgccaggaaacaatgctgctagc U17280 Human steroidogenic acute regulatory protein (StAR) mRNA, complete cggaagctagttaccatggaggatca U17327 Human neuronal nitric oxide synthase (NOS1) mRNA, complete cds. ccctaggcggtggcgatggggaccgc U17418 Human parathyroid hormone/parathyroid hormone-related peptide cattttggcttaatgatggagaaaaa U17473 Human calcitonin-like receptor mRNA, complete cds. aaggtcctctatgtgatggagctgct U17474 Human autoantigen mRNA, complete cds. gggtggctggcggtcatggcgctact U17496 Human proteasome subunit LMP7 (allele LMP7B) mRNA, complete cds. gggtggctggcggtcatggcgctact U17497 Human proteasome subunit LMP7 (allele LMP7C) mRNA, complete cds. cgtggcctgagcaggatggtgccctc U17566 Human 65 kDa hydrophobic protein mRNA, complete cds. caccacctccctaccatggacccccg U17714 Homo sapiens putative tumor suppressor ST13 (ST13) mRNA, complete tcttcactcccaacaatggcggctcc U17743 Human JNK activating kinase (JNKK1) mRNA, complete cds. caacaggaattgaaaatgaatcagaa U17838 Homo sapiens zinc finger protein RIZ mRNA, complete cds. cctcccctgacagccatgctggtcgt U17894 Human alpha(1,2)fucosyltransferase (FUT2) gene, complete cds. ccctgcctcctgaccatgtcctctct U17895 Human alpha(1,2)fucosyltransferase (Sec1) pseudogene. ccgcactctgctgctatgagcttcct U17899 Human chloride channel regulatory protein mRNA, complete cds. tcgaagcctcttaaaatggcagatga U17969 Human initiation factor eIF-5A gene, complete cds. gtctcggaggccaggatgcctgccct U17970 Human heparan sulfate N-deacetylase/N-sulfotransferase mRNA, ggctgaaagcaagcaatgctccccac U17986 Human GABA/noradrenaline transporter mRNA, complete cds. ggggccccacacacaatggacgagct U17989 Homo sapiens nuclear autoantigen GS2NA mRNA, complete cds. cacaaggaaataaagatgagtaaaag U18062 Human TFIID subunit TAFII55 (TAFII55) mRNA, complete cds. actgggtgagcaataatggtgcttcc U18088 Human 3',5'-cyclic AMP phosphodiesterase inactive splice variant tgcctcgcgggcgcaatgaatccgcg U18121 Human 136-kDa double-stranded RNA binding protein p136 (K88dsRBP) ggtctctctgcagccatgtcggccaa U18197 Human ATP:citrate lyase mRNA, complete cds. actgtggacgggaggatggagtcgat U18242 Human calcium modulating cyclophilin ligand (CAMLG) mRNA, complete aagacgttgaggagtatgaggacctg U18247 Human p67 mRNA, complete cds. tgggattcctacacaatgcgttgcct U18259 Human clone CIITA-8 MHC class II transactivator CIITA mRNA, tgggattcctacacaatgcgttgcct U18288 Human clone CIITA-10 MHC class II transactivator CIITA mRNA, cgggcccgcgccgccatgaacctaga U18291 Human CDC16Hs mRNA, complete cds. ctgctggcatcggccatggagacggt U18297 Human MST1 (MST1) mRNA, complete cds. gctccaagcctcgacatgtcgtacaa U18299 Human damage-specific DNA binding protein DDBa p127 subunit (DDB1) cacacggaggacgcgatggctcccaa U18300 Human damage-specific DNA binding protein p48 subunit (DDB2) mRNA, tccaggagtgcaaggatgatgctgaa U18321 Human ionizing radiation resistance conferring protein mRNA, acagctggacgggcaatggcgggtcg U18420 Human ras-related small GTP binding protein Rab5 (rab5) mRNA, atccgcgggtttgctatggcgatgag U18423 Human spinal muscular atrophy gene product mRNA, complete cds. cagggagcagagaccatggggcccct U18467 Human pregnancy-specific beta 1-glycoprotein 7 (PSG7) mRNA, caagcagcagagaccatggggcccct U18469 Human pregnancy-specific beta 1-glycoprotein 4 (PSG4) clone FL-64 ttcaaaggaagagcaatggctgcagc U18543 Human zinc-finger protein mRNA, complete cds. aggacaggggttaaaatgaatgaaga U18548 Human GPR12 G protein coupled-receptor gene, complete cds. gcaaatccggccgcgatgaacgcgag U18549 Human GPR6 G protein-coupled receptor gene, complete cds. tctcctgcaggtaccatgatgtgggg U18550 Human GPR3 G protein-coupled receptor gene, complete cds. ttctgcagagcccaaatggcgcagtg U18671 Human Stat2 gene, complete cds. aaccatttgccaaaaatgagtctaag U18728 Human lumican mRNA, complete cds. gggtgcttcagatcaatggatgagtt U18759 Human nuclear factor I (NFI) mRNA, clone AT1, complete cds. tcctcctcgccccgcatgctcccggc U18761 Human nuclear factor I (NFI) mRNA, clone CT1, partial cds. cacgctgagctcgggatgcggacgct U18810 Human PACAP type-3/VIP type-2 receptor mRNA, complete cds. cggcgggctggagacatggaccgcgg U18914 Human 19.8 kDa protein mRNA, complete cds. gtctcggaggccaggatgcctgccct U18918 Human heparan sulfate-N-deacetylase/N-sulfotransferase mRNA, clone gcggcgtcgccgccgatggcgctgag U18934 Human receptor tyrosine kinase (DTK) mRNA, complete cds. aagtggacagccgggatggcagagcg U18936 Human histidyl-tRNA synthetase homolog (HO3) gene, exon 1, and gcgtcctgccgcgcgatgcccctgct U18937 Human histidyl-tRNA synthetase homolog (HO3) mRNA, complete cds. taagcaggcatcaggatgttgggctg U18945 Human cyclic nucleotide gated channel gamma subunit (Gar-1) mRNA, cttttgacgaccaccatgactgagat U18985 Human triadin mRNA, complete cds. ctgaactggaagaaaatgtctatcca U18991 Human retinal pigment epithelium-specific 61 kDa protein (RPE65) ggtgccaaagcagccatggaagagcc U19107 Homo sapiens ZNF127 (ZNF127) gene, complete cds; and FNZ127 gene, tcatctgtgtgaaatatgagttggcg U19142 Human GAGE-1 protein mRNA, complete cds. tcatctgtgtgaaatatgagttggcg U19143 Human GAGE-2 protein mRNA, complete cds. tcatatttcacacagatgaatctcag U19144 Human GAGE-3 protein mRNA, complete cds. tcatctgtgtgaaatatgagttggcg U19145 Human GAGE-4 protein mRNA, complete cds. tcatctgtgtgaaatatgagttggcg U19146 Human GAGE-5 protein mRNA, complete cds. tcatctgtgtgaaatatgagttggcg U19147 Human GAGE-6 protein mRNA, complete cds. gagagctcccgcctcatgtttgaata U19178 Human (Hin-3)/HIV1 promoter region chimeric mRNA, complete cds. acgccacctttgatcatggaagaaag U19179 Human (Hin-2) mRNA, complete cds. ggctggagcagtaagatggcggccag U19180 Human B melanoma antigen (BAGE) mRNA, complete cds. gataaacctcagaaaatggccaccca U19251 Homo sapiens neuronal apoptosis inhibitory protein mRNA, complete tgacgccggacgcccatggacgcctc U19252 Human putative transmembrane protein mRNA, complete cds. ctcctctttcctaaaatggagtcgag U19260 Human LMP1 associated protein mRNA, complete cds. gcctggaaccctgagatggcctccag U19261 Homo sapiens Epstein-Barr virus-induced protein mRNA, complete cds. cctggccccaccgacatggcggcggt U19348 Human (tpr-met fusion) oncogene mRNA, complete cds. tccaggcaccccaccatgggcaatgc U19487 Human prostaglandin E2 receptor mRNA, complete cds. ccgcccgcccgcgccatgaacgccaa U19495 Human intercrine-alpha (hIRH) mRNA, complete cds. ctggccagtcccaaaatggaacataa U19517 Human (apoargC) long mRNA, complete cds. ctggccagtcccaaaatggaacataa U19518 Human (apoargC) short mRNA, complete cds. ggctgcggcgggtccatggagaaggg U19523 Human GTP cyclohydrolase I mRNA, complete cds. cacatcgagttcaccatgaattcact U19556 Human squamous cell carcinoma antigen 1 (SCCA1) mRNA, complete cds. cacatcgagttcaccatgaattcact U19557 Human squamous cell carcinoma antigen 2 (SCCA2) mRNA, complete cds. agcatctgctgagctatgagccaaac U19713 Human allograft-inflammatory factor-1 mRNA, complete cds. tgcctctttgttgccatgagagctgc U19718 Human microfibril-associated glycoprotein (MFAP2) mRNA, complete cgtggcctgagcaggatggtgccctc U19720 Human reduced folate carrier (RFC) mRNA, complete cds. ttgcagtggtgcagaatggctgacct U19727 Human microtubule-associated protein 4 (MAP4) mRNA, complete cds. gatctgactgcagccatgagcagcaa U19765 Human nucleic acid binding protein gene, complete cds. agaaggcagaacaaaatgagctgggc U19769 Human CENP-F kinetochore protein mRNA, complete cds. ggcggctgctggaaaatgtctcagga U19775 Human MAP kinase Mxi2 (MXI2) mRNA, complete cds. acagtgactgtgaccatgcggaccct U19796 Human melanoma antigen p15 mRNA, complete cds. agccgccgccgaatcatgtcgatgag U19816 Human thyroid transcription factor-1 (TTF-1) gene, complete cds. cagcctcccagcagcatggctttcac U19869 Homo sapiens fatty acid binding protein 6 (FABP6) mRNA, complete acaggggcaccagtcatgggcgccgc U19878 Human transmembrane protein mRNA, complete cds. agctgcatggacagcatgcgtctctc U19906 Human arginine vasopressin receptor 1 (AVPR1) gene, complete cds. agggcagaaagcaccatgagtggggg U19927 Human Wiskott-Aldrich syndrome (WAS) mRNA, complete cds. agaagctggcggctcatggcttcgtg U19948 Human protein disulfide isomerase (PDIp) mRNA, complete cds. gcagacatggggaccatgaagaccca U19970 Human antimicrobial LPS-binding protein CAP18 precursor mRNA, tcaacacttcactccatggcagttcc X06347 Human mRNA for U1 small nuclear RNP-specific A protein. gaattccagagcaacatgcccaagtt X12517 Human mRNA for U1 small nuclear RNP-specific C protein. tgctcagctcccaagatggtgccacc U20157 Human platelet-activating factor acetylhydrolase mRNA, complete cccgggagagcagccatggcactgag U20158 Human 76 kDa tyrosine phosphoprotein SLP-76 mRNA, complete cds. ttggctggcccagggatgacttcctc U20165 Human type II serine/threonine kinase receptor mRNA, complete cds. tggcatgttgcaaagatggtttctgc U20166 Human GABA(A) receptor alpha 4 subunit (GABRA4) gene, partial cds. gaacgtgcgggcaccatgcgtcccca U20178 Human secretin receptor precursor mRNA, complete cds. cctcaaacagacaccatggtgcacct U20223 Human thalassemia beta globin gene, complete cds. aacgtgattggggtcatgaagacgtt U20230 Human guanyl cyclase C gene, partial cds. agggagagtgcccaaatgagcaagat U20240 Human C/EBP gamma mRNA, complete cds. atttccatcagcaggatgtgggggct U20280 Human cathepsin X mRNA, complete cds. gaagttccagaatcgatggaagtgga U20285 Human Gps1 (GPS1) mRNA, complete cds. cagatagtcttcaagatgccaaactg U20324 Human LIM domain protein (CLP) mRNA, complete cds. acgagtttcagaacgatggagagctc U20325 Human cocaine and amphetamine regulated transcript CART (hCART) cgccaggccttcaccatggatcagtt U20350 Human G protein-coupled receptor V28 mRNA, complete cds. cagcgcgaggtacaaatgatgcaaaa U20362 Human Tg737 mRNA, complete cds. tcttcagggacagacatggctcagcg U20391 Human folate receptor (FOLR1) gene, complete cds. ccccgtccgcgcacgatggggcacct U20489 Human glomerular epithelial protein 1 (GLEPP1) mRNA, complete cds. ccctgatgcaggaacatggagctgat U20499 Human thermolabile phenol sulfotransferase (stm) gene, complete gcgcgtttggctgcaatgagctcggc U20536 Human cysteine protease Mch2 isoform alpha (Mch2) mRNA, complete acctggtctgggaagatgttctacca U20659 Human RNA polymerase II subunit hsRPB7 mRNA, complete cds. gcctgggccgcccggatgtgcactaa U20734 Human transcription factor junB (junB) gene, 5' region and complete ggaaaactcactaccatgagaattgc U20758 Human osteopontin gene, complete cds. agagacggcagaaccatggcatttta U20759 Human parathyroid cell calcium-sensing receptor mRNA, complete cds. agagacggcagaaccatggcatttta U20760 Human extracellular calcium-sensing receptor mRNA, complete cds. tccaggactggcgggatgggctcagc U20770 Human metastasis suppressor (KAI1) mRNA, complete cds. gcctagcccagagacatggagagttg U20816 Human nuclear factor kappa-B2 (NF-KB2) gene, partial cds. tgctgacatttcaatatgaagggcaa U20860 Human angiotensin II type 2 receptor gene, complete cds. ttcttgacgcccagaatggtcagtgc U20896 Human clone 122/3 melanoma ubiquitous mutated protein (MUM-1) gene, actgtaggcactgccatggcccctgt U20938 Human lymphocyte dihydropyrimidine dehydrogenase mRNA, complete ggagccgctgccgctatggatgatcg U20972 Human 14-3-3 protein epsilon isoform mRNA, complete cds. ggagccgccacagccatggattgcaa U20979 Human chromatin assembly factor-I p150 subunit mRNA, complete cds. tcgagactcaggaggatgaaagtcat U20980 Human chromatin assembly factor-I p60 subunit mRNA, complete cds. gtcctcgggcggtccatgctgcccct U20982 Human insulin-like growth factor binding protein-4 (IGFBP4) gene, ccactctaggccacgatgccgcagta U20998 Homo sapiens signal recognition particle subunit 9 (SRP9) mRNA, ggagctgctgcagccatgtcggccct U21049 Homo sapiens DD96 mRNA, complete cds. gccgaagtgcccaccatgggcaacca U21051 Human G protein-coupled receptor (GPR4) gene, complete cds. gtcaggagtgtggccatgttttctga U21090 Human DNA polymerase delta small subunit mRNA, complete cds. ctcctctttcctaaaatggagtcgag U21092 Human CD40 receptor associated factor 1 (CRAF1) mRNA, complete cds. cggttcccggcgaccatggtgacgat U21108 Human dual specific protein phosphatase mRNA, complete cds. aaccatttgccaaaaatgagtctaag U21128 Human lumican mRNA, complete cds. tcttcctcctaagccatggcatatca U21242 Homo sapiens transcription factor TFIIA small subunit p12 mRNA, ctgcctgccaccaccatgtctgctgc U21663 Human deleted in azoospermia protein (DAZ) mRNA, complete cds. gcagtcttcgccaccagtgagtacgc U21689 Human glutathione S-transferase-P1c gene, complete cds. tcacgcgccacagctatgtgtccccg U21730 Human 5'-nucleotidase (CD73) gene, partial cds. gccaagcagccaaccatgctcaactt U21847 Human TGF-beta inducible early protein (TIEG) mRNA, complete cds. tgatcatcggatatcatggagtctgg U21858 Human transcriptional activation factor TAFII32 mRNA, complete cds. ctgggagccgccgccatgggaatgtc U21936 Human peptide transporter (HPEPT1) mRNA, complete cds. accctgaagagcaacatgggagaaac U21943 Human organic anion transporting polypeptide (OATP) mRNA, complete catccctctaccaccatgctggcctc U22027 Human cytochrome P450 (CYP2A6V2) gene, complete cds. catcccatggccaccatgctggcctc U22028 Human cytochrome P450 (CYP2A13) gene, complete cds. catctcactaccaccatgctggcctc U22029 Human cytochrome P450 (CYP2A7) mRNA, complete cds. catctcactaccaccatgctggcctc U22030 Human cytochrome P450 (CYP2A7PT) pseudogene mRNA, partial cds. catctcactaccaccatgctggcctc U22044 Human cytochrome P450 (CYP2A7PC) pseudogene mRNA, partial cds. cggggcatcatcaagatggtcctctc U22055 Human 100 kDa coactivator mRNA, complete cds. tcaaccagaatcaagatgtctgggac U22171 Human DNA repair and recombination RAD52 pseudogene, partial cds. ctttcccgtgcagacatggcctctgg U22233 Human methylthioadenosine phosphorylase (MTAP) mRNA, complete cds. accagacgcggagccatggccgaggt U22302 Homo sapiens histo blood group ABO glycosyltransferase (ABO) gene, tggccgaatacagttatggccaccca U22314 Human REST protein mRNA, complete cds. ccccaccaaggcacaatgagcaacat U22322 Human nuclear tyrosine protein kinase Rak mRNA, complete cds. ttcaggtcactgtgcatggcatcatc U22346 Human bradykinin B1 receptor (bradyb1) gene, complete cds. gccgcccgccgcgccatggcccgaag U22376 Human (c-myb) gene, complete primary cds, and five complete gacccagctgcccgtatgaccgcgcc U22386 Human macrophage-colony stimulating factor gamma precursor mRNA, gcgcagccccgggccatgtccgacgc U22398 Human Cdk-inhibitor p57KIP2 (KIP2) mRNA, complete cds. ggggaccgattcaccatggagggcgc U22431 Human hypoxia-inducible factor 1 alpha (HIF-1 alpha) mRNA, complete tctgccctcgttgagatggacaacgc U22491 Human G protein-coupled receptor (GPR7), complete cds. acggtcccagctacaatgcaggccgc U22492 Human G protein-coupled receptor gene (GPR8), complete cds. agcactgcagcagcaatgacggaggg U22526 Human 2,3-oxidosqualene-lanosterol cyclase mRNA, complete cds. gggctccagaaagagatgtccttgtg U22662 Human nuclear orphan receptor LXR-alpha mRNA, complete cds. aggccgaatacagttatggccaccca U22680 Human X2 box repressor mRNA, complete cds. ccgccggcgagcaagatgatgtgcga U22815 Human LAR-interacting protein 1a mRNA, complete cds. ccgccggcgagcaagatgatgtgcga U22816 Human LAR-interacting protein 1b mRNA, complete cds. ccctggacccctaccatggaggagac U22897 Homo sapiens nuclear domain 10 protein (ndp52) mRNA, complete cds. ggacagagcgtgaccatggccaggct U22954 Human immunoglobulin-associated (B29) gene, promoter and exon 1, cacgcctttggcacaatgaagtgggt U22961 Human mRNA clone with similarity to L-glycerol-3-phosphate:NAD gcgcgcggcgccaccatgcggcagaa U22970 Y00828 Human interferon-inducible peptide (6-16) gene, complete cds. ccgtgcggggcgtcaatggatcgcca U23070 Human putative transmembrane protein (nma) mRNA, complete cds. gggcagctggtcaggatggccattcg U23143 Human mitochondrial serine hydroxymethyltransferase gene, nuclear aaggctctgataaccatgaggcttct U23157 Human pro-alpha-S1-casein mRNA, complete cds. acaccttggccaacaatgtcctgcag U23435 Human Abl interactor 2 (Abi-2) mRNA, complete cds. ccgtccgccgcggccatggccaccac U23460 Human proline rich calmodulin-dependent protein kinase mRNA, gccctgcaacggatcatggtgcagca U23752 Human SOX-11 mRNA, complete cds. actgagacctgaaaaatggcttcggg U23765 Human Bak protein mRNA, complete cds. gcccgggccttggagatggagaattc U23803 Human heterogeneous ribonucleoprotein A0 mRNA, complete cds. tccacagcctgaagaatgaagacacg U23851 Human atrophin-1 mRNA, complete cds. ggctgggcagggaccatgggctgtgg U23852 Human T-lymphocyte specific protein tyrosine kinase p56lck (lck) gaggcaccggtggccatggggctgga U23853 Human dual-specific phosphoprotein phosphatase (PAC1) gene, tttccgacggagtgaatggcggcggc U23942 Human lanosterol 14-demethylase cytochrome P450 (CYP51) mRNA, atcttcagtgggacaatgggttcaga U23946 Human putative tumor suppressor (LUCA15) mRNA, complete cds. tccccagcagaagcgatgggcagtgt U24055 Human inward rectifier K+ channel protein (hirk1) mRNA, complete cgccggcttcaggacatgcacggaca U24056 Human inward rectifier K+ channel protein (hirk2) mRNA, complete tgcacagacagcaccatgtcgctcat U24074 Human p58 natural killer cell receptor precursor mRNA, clone cl-6, tgctccggcagcaccatgtcgctctt U24076 Human p58 natural killer cell receptor precursor mRNA, clone cl-42, tgctccggcagcaccatgtcgctctt U24078 Human p58 natural killer cell receptor precursor mRNA, clone 47.11, tcggagacctgagagatgttaaccaa U24105 Homo sapiens coatomer protein (COPA) mRNA, complete cds. gcgagtgtgtgagctatggagcgaag U24128 Human prohormone convertase (PC1/3) gene, promoter and 5' flanking ctgctggtggtgacaatgtcaaataa U24152 Homo sapiens p21-activated protein kinase (Pak1) mRNA, complete tcataattctgaatcatgtctgataa U24153 Homo sapiens p21-activated protein kinase (Pak2) mRNA, complete catcctgccgggatcatggtctgcgg U24163 Human Frizzled related protein Frzb precursor (fzrb) mRNA, complete tgctttggttctgccatgccgatgta U24169 Human JTV-1 (JTV-1) mRNA, complete cds. attctgggcagcaggatgggtgtgga U24183 Human phosphofructokinase (PFKM) mRNA, complete cds. tgagctgtcttgaagatgagtaagag U24186 Homo sapiens replication protein A complex 34 kd subunit homolog cgcccgccgctcgccatggatgccgg U24223 Human alpha-CP1 mRNA, complete cds. cttgcagaccccgccatggacccgtt U24231 Human Fas-associating death domain-containing protein mRNA, cgcttctaacccgagatgctgctgcc U24266 Human pyrroline-5-carboxylate dehydrogenase (P5CDh) mRNA, long cgcttctaacccgagatgctgctgcc U24267 Human pyrroline-5-carboxylate dehydrogenase (P5CDh) mRNA, short acaaccccagactccatgcgcctctc U24488 Human tenascin-X (XA) mRNA, complete cds. cgcgctgccctaacgatgccgcccgc U24497 U24499 Human autosomal dominant polycystic kidney disease protein 1 (PKD1) tgctcagctcccaagatggtgccacc U24577 Human LDL-phospholipase A2 mRNA, complete cds. ttggatcctccagccatgaggctgct U24578 Human RP1 and complement C4B precursor (C4B) genes, partial cds. gaagaaactgcaacaatggccaagct U24660 Human G protein coupled inward rectifier potassium channel 2 gaggaaggtggcaagatggtgttgga U24704 Human antisecretory factor-1 mRNA, complete cds. accattcttggaaccatggcggcagt U25033 Human neuronatin alpha mRNA, complete cds. accattcttggaaccatggcggcagt U25034 Human neuronatin beta mRNA, complete cds. gccgctcgcggaccgatgctgccggc U25041 Homo sapiens 5C5 mRNA, complete cds. ttggctggcccagggatgacttcctc U25110 Human bone morphogenic protein type II receptor mRNA, complete cds. tgatcatcggatatcatggagtctgg U25112 Human TBP-associated factor TAFII31 mRNA, complete cds. acagccgttccgggcatggccgggct U25128 Human PTH2 parathyroid hormone receptor mRNA, complete cds. gggaacagacccaagatgttggggag U25134 Human carbonic anhydrase V (CA-V) gene, nuclear gene encoding ctgcccccagtgaatatggtgaagaa U25138 Human MaxiK potassium channel beta subunit mRNA, complete cds. cgcctcccgcccgccatgcccgcgcc U25147 Human citrate transporter protein mRNA, nuclear gene encoding tgcgctcgcgtggtcatggaggcgct U25182 Human antioxidant enzyme AOE37-2 mRNA, complete cds. cctctttaacctgtaatgctgtggct U25265 Human MEK5 mRNA, complete cds. aggcccggggacaccatggccgagcc U25278 Human ERK5 mRNA, complete cds. gtttagaagtttacaatgaagtttct U25346 Human metalloelastase gene, partial cds and promoter region. ggagaggcaggggaaatggaaggtga U25435 Human transcriptional repressor (CTCF) mRNA, complete cds. cacctcctctgggctatggcatctct U25441 Human dopamine D3 receptor (DRD3) gene, complete cds. tcaactcctgccacaatgtacaggat U25676 Human interleukin 2 (IL2) mRNA, complete cds. gcgccttagctcactatggggaacca U25771 Human ADP-ribosylation factor mRNA, complete cds. cagtaattcgccaaaatgacgaacac U25789 Human ribosomal protein L21 mRNA, complete cds. cagaggctgttccctatggcagaagg U25804 Human Ich-2 cysteine protease mRNA, complete cds. tctcccaccggcccgatgagctgcag U25816 Human TATA-binding protein associated factor II 30 (TAFII30) gene, gagggggcaccgcccatgctgccctg U25826 Human transcription factor (SC1) gene, complete cds. cacgcagcagagatcatggggcccct U25988 Human pregnancy-specific glycoprotein 13 (PSG13') mRNA, complete gaaacttctcagagaatgctccaaaa U25997 Homo sapiens stanniocalcin precursor (STC) mRNA, complete cds. aattaaacaaccaccatgtcgagcaa U26162 Human myosin regulatory light chain mRNA, complete cds. gtaaggttgtttctgatgcagctgag U26173 Human bZIP protein NF-IL3A (IL3BP1) mRNA, complete cds. atctaaatctttaaaatgactaagtt U26174 Human pre-granzyme 3 mRNA, complete cds. ttgctgctccacaccatggccacctg U26209 Human renal sodium/dicarboxylate cotransporter (NADC1) mRNA, ccctgacgcaggaacatggagctgat U26309 Human phenol sulfotransferase mRNA, complete cds. atcaccaatgacatcatgacagcaag U26398 Human inositol polyphosphate 4-phosphatase mRNA, complete cds. gtgcaggcgcgcgtcatggctgcttt U26401 Human galactokinase (galK) mRNA, complete cds. cgctggccaggcgtgatgttgcacgt U26403 Human receptor tyrosine kinase ligand LERK-7 precursor (EPLG7) tctgtcccggccgccatggagcagcc U26424 Human Ste20-like kinase (MST2) mRNA, complete cds. gcccctggccgggccatggcgggcgc U26425 Human phospholipase C-beta-3 (PLCB3) gene, complete cds. cggcggggtttccgcatgggccggac U26446 Human protoporphyrinogen oxidase mRNA, complete cds. gtggtggagttattgatgacgttaca U26455 Human phosphatidylinositol 3-kinase homolog (ATM) mRNA, complete cttcaaaaaccaaaaatgaggttcac U26553 Human calcitonin receptor mRNA, complete cds. tgaggacgaaagaagatgatggatgc U26554 Human calcitonin receptor isoform mRNA, complete cds. ccttccaaggccaagatgttcataaa U26555 Human versican V2 core protein precursor splice-variant mRNA, ctctccttagcctccatgttgactac U26556 Human ferritin H (FTHL13) pseudogene. tcttctggcgccaaaatgtcgttcgt U26559 Human DNA mismatch repair (hMLH1) gene, 5' flanking region, partial gaagaagaagaaaacatgtcaggaca U26591 Human clone IS10 diabetes mellitus type I autoantigen (ICAp69) gaagaagaagaaaacatgtcaggaca U26592 Human clone IS4 diabetes mellitus type I autoantigen (ICAp69) mRNA, gaagaagaagaaaacatgtcaggaca U26593 Human clone 61.1 diabetes mellitus type I autoantigen (ICAp69) gcgcgcgtggccgccatggcgcggaa U26596 Human ribosomal protein L23-related mRNA, complete cds. gaaggccccgacaccatgtcctgccg U26648 Homo sapiens syntaxin 5 mRNA, complete cds. gaactaaaattccagatggcaaactc U26710 Human cbl-b mRNA, complete cds. gaactaaaattccagatggcaaactc U26711 Human cbl-b truncated form 1 lacking leucine zipper mRNA, complete gaactaaaattccagatggcaaactc U26712 Human cbl-b truncated form 2 lacking leucine zipper mRNA, complete tcgggaaagtcaggcatggatgctgc U26724 Homo sapiens calpastatin (BS-17) mRNA, complete cds. cagcccgctggcgccatggagcgctg U26726 Human 11-beta-hydroxysteroid dehydrogenase type 2 mRNA, complete ggaggcggcgagaacatggtgcgcag U26727 Human p16INK4/MTS1 mRNA, complete cds. tcattgaattttagaatgattgaaga U26742 Human dystrobrevin-delta mRNA, complete cds. gaacctttgcaccccatgttcccaga U26743 Human dystrobrevin-zeta mRNA, complete cds. tcattgaattttagaatgattgaaga U26744 Human dystrobrevin-gamma mRNA, complete cds. ccctatgactgctccatggagcccat U26914 Human ras-responsive element binding protein (RREB-1) mRNA, cttcaaactactgagatgaagggggc U27109 Human prepromultimerin mRNA, complete cds. gggagagaggccgagatggcagatga U27143 Human protein kinase C inhibitor-I cDNA, complete cds. aactttcctgcgtccatgcagccccg U27185 Human RAR-responsive (TIG1) mRNA, complete cds. acccattgccccaccatggctgggga U27193 Human protein-tyrosine phosphatase mRNA, complete cds. tatcaacagagctgaatgagtgccag U27203 Homo sapiens retinal dystrophin (DMD) gene, retinal dystrophin exon ccagccagtccagcaatgatggaaaa U27266 Human myosin binding protein H (MyBP-H) gene, complete cds. ctgcctctcagcaggatggacgtgat U27313 Human MYF-5 (myf-5) gene, promoter region and partial cds. cagggctccggagccatgtggcccaa U27325 Human thromboxane A2 receptor mRNA, complete cds. aagatactctgacccatggatcccct U27326 Human alpha (1,3/1,4) fucosyltransferase (FUT3) mRNA, major aagatactctgacccatggatcccct U27327 Human alpha (1,3/1,4) fucosyltransferase (FUT3) mRNA, major aagatactctgacccatggatcccct U27328 Human alpha (1,3/1,4) fucosyltransferase (FUT3) mRNA, minor tagctactctgacccatggatcccct U27329 Human alpha (1,3) fucosyltransferase (FUT5) mRNA, minor transcript tagctactctgacccatggatcccct U27330 Human alpha (1,3) fucosyltransferase (FUT5) mRNA, minor transcript cagagactctgacccatggatcccct U27333 Human alpha (1,3) fucosyltransferase (FUT6) mRNA, major transcript cagagactctgacccatggatcccct U27334 Human alpha (1,3) fucosyltransferase (FUT6) mRNA, major transcript cagagactctgacccatggatcccct U27335 Human alpha (1,3) fucosyltransferase (FUT6) mRNA, minor transcript cagagactctgacccatggatcccct U27336 Human alpha (1,3) fucosyltransferase (FUT6) mRNA, minor transcript cagagactctgacccatggatcccct U27337 Human alpha (1,3) fucosyltransferase (FUT6) mRNA, minor transcript aaaaggttggcaacaatgagtaaacc U27459 Human origin recognition complex protein 2 homolog hORC2L mRNA, gatcttagcaaagcaatgtctcaaga U27460 Human uridine diphosphoglucose pyrophosphorylase mRNA, complete tccaccaggcagaagatgacagactg U27467 Human Bcl-2 related (Bfl-1) mRNA, complete cds. tgctgacatttcaatatgaagggcaa U27478 Homo sapiens angiotensin II type 2 receptor (AT2) gene, partial tcaaccagaatcaagatgtctgggac U27516 Human recombination protein RAD52 mRNA, complete cds. gctgtacaatagtggatgtttgagac U27655 Human RGP3 mRNA, complete cds. acccaccacacagccatggacgggaa U27699 Human pephBGT-1 betaine-GABA transporter mRNA, complete cds. aagctgttaaataagatgtgcaaagg U27768 Human RGP4 mRNA, complete cds. cagaggctgttccctatggcagaagg U28014 Human cysteine protease (ICErel-II) mRNA, complete cds. aagaattttgaagctatgttcaaagg U28015 Human cysteine protease (ICErel-III) mRNA, complete cds. gccgccgccgccgcaatgggcaaaac U28042 Human DEAD box RNA helicase-like protein mRNA, complete cds. ctgacggccagcgccatggcttacca U28049 Human TBX2 (TXB2) mRNA, complete cds. agcgctcgccattgaatgacttccag U28054 Homo sapiens hepatocyte growth factor-like protein homolog gene, gcccccctcgatcggatggggaagcc U28164 Homo sapiens spermatogenesis associated PD1 mRNA, complete cds. caagagctcaggaacatggagctgat U28169 Human clone hast4v aryl sulfotransferase mRNA, complete cds. caagagctcaggaacatggagctgat U28170 Human clone hast4 aryl sulfotransferase mRNA, complete cds. ggccagcgctctgacatgcagaaggt U28249 Human 11kd protein mRNA, complete cds. gaacgtgcgggcaccatgcgtcccca U28281 Human secretin receptor mRNA, complete cds. tcctcagctagtgacatggtcgatat U28282 Human zinc finger protein (ZNF741) mRNA, complete cds. cgcagggcgcgcgcgatgaaggcggt U28368 Human Id-related helix-loop-helix protein Id4 mRNA, complete cds. ccctgagctgctgagatggggcgggc U28369 Homo sapiens semaphorin V mRNA, complete cds. ctttgtctcataaccatgtccaccaa U28386 Human nuclear localization sequence receptor hSRP1alpha mRNA, tcgggtcgcggcaggatggttgcctc U28387 Human hexokinase II pseudogene, complete cds. cgagctccgtgctgcatggaacggct U28389 Human dematin 52 kDa subunit mRNA, complete cds. gtgtgaggacacgatatgctggggtt U28413 Human Cockayne syndrome complementation group A CSA protein (CSA) tcgcgagcctcggacatggtggcccc U28424 Human protein kinase inhibitor p58 mRNA, complete cds. ttttgaagtttagcaatggcgtcttt U28488 Human putative G protein-coupled receptor (AZ3B) mRNA, complete aggacttgaactgccatgtcctctga U28686 Human putative RNA binding protein RNPL mRNA, complete cds. gaggccagggtgaacatgccagctaa U28687 Human zinc finger containing protein ZNF157 (ZNF157) mRNA, complete acagggagaagtgaaatgacaacctc U28694 Human eosinophil CC chemokine receptor 3 mRNA, complete cds. gggggaacgtcggacatgcggctctg U28727 Human pregnancy-associated plasma protein-A preproform (PAPPA) gcggcgggaggcaggatgagcgcacg U28749 Human high-mobility group phosphoprotein isoform I-C (HMGIC) mRNA, cgccgcggactcaagatggcggcgtg U28811 Human cysteine-rich fibroblast growth factor receptor (CFR-1) mRNA, ccactgtgaaacagaatggtgtatgc U28833 Homo sapiens Down syndrome candidate region protein (DSCR1) mRNA, gagctcgcagggaccatgtatcagag U28835 Human GATA-4 gene, partial cds. ccgccggtcgccggcatgacgggccg U28838 Human transcription factor TFIIIB 90 kDa subunit (hTFIIIB90) mRNA, caccacctccctaccatggacccccg U28918 Human progesterone receptor-associated p48 protein mRNA, complete gaggggcgcgcggagatggcagcgtc U28926 Human beta2-chimaerin mRNA, complete cds. cgccaggccttcaccatggatcagtt U28934 Human beta chemokine receptor-like 1 mRNA, complete cds. tttccttgtaggcaaatgtgcaatac U28935 Human p53-associated mdm2 protein (mdm2) gene, partial cds. ttgccggctgtcggtatgtcgcgaca U28946 Human G/T mismatch binding protein (GTBP) mRNA, complete cds. gcccacggcagcaccatgcccgcact U28963 Human Gps2 (GPS2) mRNA, complete cds. acagaacatccagtcatggataaaaa U28964 Homo sapiens 14-3-3 protein mRNA, complete cds. cagaggctgttccctatggcagaagg U28976 Human apoptotic cysteine protease Mih1/TX isoform alpha (mih1/Tx) aaaagaaatattacgatgctaaaact U28977 Human apoptotic cysteine protease Mih1/TX isoform beta (mih1/Tx) gacaaagttcgggtcatggcagactc U28978 Human apoptotic cysteine protease Mih1/TX isoform gamma (mih1/Tx) gcagctcatccgaatatggaggctgg U28979 Human apoptotic cysteine protease Mih1/TX isoform delta (mih1/Tx) tgcatcacctggatcatgaggtcacc U29089 Human proline- arginine-rich end leucine-rich repeat protein PRELP cgagggactttgaacatgtcggggat U29092 Homo sapiens ubiquitin conjugating enzyme mRNA, complete cds. atctgccaggaaagaatgctgctagc U29106 Human steroidogenic acute regulatory protein (StAR) pseudogene. ggggaccgattcaccatggagggcgc U29165 Human MOP1 mRNA, complete cds. cgggccgccgccgccatggagctgag U29171 Human casein kinase I delta mRNA, complete cds. gcagctcccgtgaagatgtccactcc U29175 Human transcriptional activator (BRG1) mRNA, complete cds. tgcagagcagtcattatggcgaacct U29185 Homo sapiens prion protein (PrP) gene, complete cds. tcgccccgcaggaccatggccaacct U29200 Human nucleoside diphosphate kinase B (nm23-H2) gene, 5'-region and aagccaggagtcaaaatgactgagcg U29332 Homo sapiens heart protein (FHL-2) mRNA, complete cds. gagctggccgtcaacatgtcctttcc U29343 Homo sapiens hyaluronan receptor (RHAMM) mRNA, complete cds. ctcaccagagcagccatggaggaggt U29344 Human breast carcinoma fatty acid synthase mRNA, complete cds. gcagacccaccctccatgaagccccc U29366 Human thimet oligopeptidase (THOP1) mRNA, complete cds. gcagacccaccctccatgaagccccc U29367 Human thimet oligopeptidase (THOP1) gene, 5' region and exon 1. tacaaggtgggcaccatggcggagaa U29538 Human heart protein with four and a half LIM domains (FHL-1) mRNA, ctaaaaatagcaaagatgcttttgag U29584 Human interferon alpha-beta receptor, beta subunit long form mRNA, tgtcagagagtcacaatgaccttgca U29589 Human m3 muscarinic acetylcholine receptor (CHRM3) gene, complete tctctctcgggcaacatggcgggcgt U29607 Human methionine aminopeptidase mRNA, complete cds. tcccgcaccgccatcatgatctgcct U29656 Human DR-nm23 mRNA, complete cds. tccaccaggcagaagatgacagactg U29680 Human A1 protein mRNA, complete cds. ccatcctccagcaagatgctagggtc U29700 Human anti-mullerian hormone type II receptor precursor gene, agtagccaagacaccatggccgagcc U29725 Human BMK1 alpha kinase mRNA, complete cds. ctttgaacaaacaccatggccgagcc U29726 Human BMK1 beta kinase mRNA, complete cds. aggcgcggggacaccatggccgagcc U29727 Human BMK1 gamma kinase mRNA, complete cds. gggcccccggccgaaatgacagtgct U29874 Human Flt3 ligand gene and Flt3 ligand alternatively spliced tgactaagatcaatcatggtaagtgc U29895 Human 4-hydroxyphenylpyruvate-dioxygenase gene, complete cds. aaggtaattgctgccatggaaacaca U29943 Human ELAV-like neuronal protein-2 Hel-N2 mRNA, complete cds. cttgcaggccccaggatgcaggccct U29953 Human pigment epithelium-derived factor gene, complete cds. cgcggccgcctcagcatgtcggactt X64044 H.sapiens mmRNA for large subunit of splicing factor U2AF. acgggaggctgcaggatggtcaagct X13482 Human mRNA for U2 snRNP-specific A' protein. ttgcagggcagtggcatggagcccct U30185 Human orphan opioid receptor mRNA, complete cds. gggggtcgggcagctatggagccgcg U30246 Human bumetanide-sensitive Na-K-Cl cotransporter (NKCC1) mRNA, tgcaccggcagcaccatgtcgctcat U30274 Human KIR (cl-11) NK receptor precursor protein mRNA, complete cds. ccttaggataagaccatggccttgag U30313 Human diadenosine tetraphosphatase mRNA, complete cds. tcccgggccgcagccatgaacggcga U30329 Human insulin promoter factor 1 (IPF1) mRNA, complete cds. gggaaaaagaaagaaatgggaaacag U30473 Homo sapiens src-like adapter protein (SLAP) mRNA, complete cds. ggggacggcagcaccatggacccccg U30498 Human retinoic acid-inducible E3 protein mRNA, complete cds. tgatcatcggatatcatggagtctgg U30504 Human transcription initiation factor TFIID subunit TAFII31 mRNA, actaagattctcaaaatggtttatta U30521 Human P311 HUM (3.1) mRNA, complete cds. ggaacataatttctcatggcagtgtt U30610 Human CD94 protein mRNA, complete cds. tacagacagctgaccatggaagcgaa U30787 X06048 Human uroporphyrinogen decarboxylase (URO-D) gene, complete cds. cgtcgggcggtgcggatgtcgggctg U30825 Human splicing factor SRp30c mRNA, complete cds. tactagccggacatcatgagtggctg U30826 Human splicing factor SRp40-1 (SRp40) mRNA, complete cds. tactagccggacatcatgagtggctg U30827 Human splicing factor SRp40-3 (SRp40) mRNA, complete cds. ccgcccgccacggacatgccgcgcgt U30828 Human splicing factor SRp55-2 (SRp55) mRNA, complete cds. ccgcccgccacggacatgccgcgcgt U30829 Human splicing factor SRp55-3 (SRp55) mRNA, partial cds. agaaggcagaacaaaatgagctgggc U30872 Human mitosin mRNA, complete cds. ccgcccgccacggacatgccgcgcgt U30883 Human splicing factor SRp55-1 (SRp-55) mRNA, complete cds. tactagccggacatcatgagtggctg U30884 Human splicing factor SRp40-2 (SRp40) mRNA, complete cds. ccgccgcgccccgccatgccgctcta U30888 Human tRNA-guanine transglycosylase mRNA, complete cds. agaccacctgccgtgatgctgaagtt U30891 Human pyruvate carboxylase precursor, mRNA, nuclear gene encoding gttgttattacagctatgaagtctta U30930 Human UDP-Galactose ceramide galactosyl transferase (CGT) mRNA, ccttcatgggccgcgatgatggcggc U31110 Human alternatively spliced trp-1 protein and unspliced trp-1 ggcgggcgcgggaagatggcggcagc U31116 Human beta-sarcoglycan A3b mRNA, complete cds. ttggcactgggcctcatggcgctttt U31120 Human interleukin-13 (IL-13) precursor gene, complete cds. gacttcaagacgtggatgcggacgca U31176 Homo sapiens ERV1 (ERV1) mRNA, complete cds. gcgcgcgccagaggcatggagcgctg U31202 Human noggin (NOGGIN) gene, complete cds. taggatcgtcccgctatgatggaagt U31214 Human (nmc) mRNA, partial cds. ctcgtcctcaccaccatggtcgggct U31215 Human metabotropic glutamate receptor 1 alpha (mGluR1alpha) mRNA, ctcctgacgcccaaaatggcagctaa U31248 Human zinc finger protein (ZNF174) mRNA, complete cds. tttgtgtccctggccatggcgctgca U31278 Homo sapiens mitotic feedback control protein Madp2 homolog mRNA, ctgctcccgcacgccatgaagtcgcc U31332 Human DP prostanoid receptor (PTGDR) gene, 5' region and partial agcaggggcagtagaatgaaagaggg U31382 Human G protein gamma-4 subunit mRNA, complete cds. cccagcgccgccgccatgtcctccgg U31383 Human G protein gamma-10 subunit mRNA, complete cds. ggttctggggcgaaaatgcctgccct U31384 Human G protein gamma-11 subunit mRNA, complete cds. ggcaccggcagcaccatgttgctcat U31416 Homo sapiens killer cell Ig-like receptor (KIR3DL1) mRNA, complete tcgtaccaccccagaatgtgcactgg U31449 Human intestinal and liver tetraspan membrane protein (il-TMP) ctaccgagcgcgtctatgagcgcagc U31468 Homo sapiens homeobox protein (GBX2) gene, complete cds. ggcggtggcggcgccatgggcggcct U31501 Human fragile X mental retardation syndrome related protein (FXR2) tgtaaagccatagagatggcctgtcc U31511 Human inducible nitric oxide synthase (NOS) mRNA, complete cds. cagcactctgcagaaatgcctcctca U31519 Human phosphoenolpyruvate carboxykinase (PCK1) gene, promoter gcacccggcagcaccatgacagatca U31525 Human glycogenin mRNA, complete cds. cggggccgggacgcgatggcggcggc U31556 Human transcription factor E2F-5 mRNA, complete cds. aggcaagttgcactcatggcacctcc U31601 Human tyrosine protein kinase (Jak3B) splice variant mRNA, complete tgtggagctgccgccatggccccgcg U31628 Human interleukin-15 receptor alpha chain precursor (IL15RA) mRNA, aagagggactccagaatggctgagga U31659 Human TBP-associated factor TAFII80 mRNA, complete cds. ggacaggcagccaccatgagcctcag U31760 Human cGMP-phosphodiesterase beta-subunit gene, partial cds. accattcttggaaccatggcggcagt U31767 Human neuronatin alpha and neuronatin beta genes, complete cds. gtggccggggagcccatggcgtacag U31814 Human transcriptional regulator homolog RPD3 mRNA, complete cds. tagataaacttcggcatggcgggtta U31850 Human dystonin isoform 1 mRNA, partial cds. cagacaccaaccactatgctgtcagc U31875 Human Hep27 protein mRNA, complete cds. cgagggactttgaacatgtcggggat U31882 Human ubiquitin-conjugating enzyme 9 mRNA, complete cds. gggtgggggggaaagatggcggagct U31903 Human CREB-RP (creb-rp) mRNA, complete cds. agagaatctgaagggatgatggatgc U31905 Human prostate-specific transglutaminase (hTGP) mRNA, complete cds. cagcggttgcgaagaatggaacgaag U31906 Homo sapiens golgin-245 mRNA, complete cds. cgggcgccgcgggccatggcgggcca U31929 Human orphan nuclear receptor (DAX1) gene, complete cds. ccttctggctctgccatgccctgctc U31930 Human deoxyuridine nucleotidohydrolase mRNA, complete cds. cgagggactttgaacatgtcggggat U31933 Human ubiquitin conjugating enzyme homolog mRNA, complete cds. aaagcaagccacaccatgggtgagat U31973 Human phosphodiesterase A' subunit (PDE6C) mRNA, complete cds. cagtcttccaggattatggagtttct U31986 Human cartilage-specific homeodomain protein Cart-1 mRNA, complete cgcctgggcttcaggatgaaggaccg U32315 Human syntaxin 3 mRNA, complete cds. tacctctccccacagatgagcagcag U32323 Human interleukin-11 receptor alpha chain gene, complete cds. gctgggatcaccgagatgagcagcag U32324 Human interleukin-11 receptor alpha chain mRNA, complete cds. ccacaggaatacctaatgcctttttt U32331 Homo sapiens RIG mRNA, complete cds. tccttatttactgcaatgttctttgc U32376 Human channel associated protein of synapse (chapsyn-110) mRNA, ggacctgtactgaaaatgggtccaat U32500 Human type 2 neuropeptide Y receptor mRNA, complete cds. gaattgaccaaagcaatggtgatgga U32519 Human GAP SH3 binding protein mRNA, complete cds. cttcctgcgccagccatgcctttaaa U32573 Homo sapiens UDP glucose:glycogen 4-alpha-D- glycosytransferase acggaacccccagaaatgtccctcct U32576 Human apolipoprotein apoC-IV (APOC4) gene, complete cds. tacacgttagaaagtatgctgcatga U32581 Homo sapiens lambda/iota protein kinase C-interacting protein mRNA, ctctgaaaagacagcatggctattac U32645 Human myeloid elf-1 like factor (MEF) mRNA, complete cds. ttggaagaaacaacgatgactcctgg U32659 Human IL-17 mRNA, complete cds. tttgaacaggtggccatggcctcatc U32672 Human orphan receptor GPR10 (GPR10) gene, complete cds. cctgaacttgatgcgatgggaggctg U32680 Homo sapiens CLN3 protein (CLN3) mRNA, complete cds. gcggaccgggggatcatggaagctga U32849 Homo sapiens Nmi mRNA, complete cds. cagctggatgtcaggatgcgtgtggt U32907 Human p37NB mRNA, complete cds. ttctccacggtaaccatgtgcgaccg U32944 Human cytoplasmic dynein light chain 1 (hdlc1) mRNA, complete cds. tattttcaagagaagatgacttttaa U32974 Human IAP-like protein ILP mRNA, complete cds. gctccaagcctcgacatgtcgtacaa U32986 Human xeroderma pigmentosum group E UV-damaged DNA binding factor cagtgccttttcaccatgagtgggtg U32989 Human tryptophan oxygenase (TDO) mRNA, complete cds. tctcctcattggctgatggatcccaa U33017 Human signaling lymphocytic activation molecule (SLAM) mRNA, gggcggcaggaggacatggccagcga U33053 Human lipid-activated protein kinase PRK1 mRNA, complete cds. cggcggcgccaggacatggagctcga U33054 Human G protein-coupled receptor kinase GRK4 mRNA, alpha splice cggcggcgccaggacatggagctcga U33055 Human G protein-coupled receptor kinase GRK4 mRNA, beta splice cggcggcgccaggacatggagctcga U33056 Human G protein-coupled receptor kinase GRK4 mRNA, gamma splice agcagcagcctcaccatgaagttgct U33147 Human mammaglobin mRNA, complete cds. attcaagttttcaagatgaagttttt U33267 Human glycine receptor beta subunit (GLRB) mRNA, complete cds. ctgctgcctgagaggatgtctggggt U33284 Human protein tyrosine kinase PYK2 mRNA, complete cds. cgagatcctatagcaatggaactcag U33286 Human chromosome segregation gene homolog CAS mRNA, complete cds. ccagcgaccctagccatgagaaccct U33317 Human defensin 6 (HD-6) gene, complete cds. ggcaccggcagcaccatgttgctcat U33328 Homo sapiens killer cell Ig-like receptor variant (KIR3DL1) mRNA, ctgcctggggaagcaatgcaagtctc U33428 Human K+ channel beta 1a subunit mRNA, alternatively spliced, agtgaggctggctccatgtatccaga U33429 human K+ channel beta 2 subunit mRNA, complete cds. cccttgtcctgggccatggcccagaa U33446 Human prostasin gene, complete cds. gactccagccaaagcatgaatggcct U33447 Human putative G-protein-coupled receptor (GPR17) gene, complete agcctaggtgtgtccatggcgtcagg U33448 Human putative G-protein-coupled receptor (GPR16) gene, complete aaacggacctggaggatgttgatctc U33460 Human DNA-directed RNA polymerase I largest subunit mRNA, complete gcgcagcgaagcccgatgtggtccgg U33627 Human thyroid transcription factor-1 (TTF-1) gene, partial cds. gcggcggtggagaagatgctgcagtc U33632 Human two P-domain K+ channel TWIK-1 mRNA, complete cds. cctgagcccgccgcgatgggagctgc U33635 Human colon carcinoma kinase-4 (CCK4) mRNA, complete cds. agccgccgccgaatcatgtcgatgag U33749 Human thyroid transcription factor-1 (TTF-1) mRNA, complete cds. ttaacaccgaacaccatgccttcaat U33760 Human cyclin A/CDK2-associated p19 (Skp1) mRNA, complete cds. agctctgcaagtttaatgcacgtatt U33761 Human cyclin A/CDK2-associated p45 (Skp2) mRNA, complete cds. gtggggggcggggagatgaacgctgc U33818 Human inducible poly(A)-binding protein mRNA, complete cds. tccactggattcacaatgacatcctt U33821 Homo sapiens tax1-binding protein TXBP151 mRNA, complete cds. atcgcgaaagcaaccatggaagacct U33822 Human tax1-binding protein TXBP181 mRNA, complete cds. tatttgcaaaggtccatggctaatga U33833 Human CHL1-related helicase (CHLR1) mRNA, complete cds. gggaccgtcgcggagatggatcgcgg U33837 Human glycoprotein receptor gp330 precursor, mRNA, complete cds. ctgaaattgtgaaccatgagtctagt U33841 Human ataxia telangiectasia (ATM) mRNA, complete cds. cagtccactgctctgatgccgaaggg U33849 Human lymphoma proprotein convertase (LPC) mRNA, complete cds. ccctgacgcaggaacatggagctgat U33886 Human arylamine sulfotransferase (STP2) gene, complete cds. taggcccctcccacaatgcttgtcgc U33920 Human clone lambda 5 semaphorin mRNA, complete cds. aatattctctttggaatggggaatcc U33936 Human adenosine kinase mRNA, complete cds. ggggcttccaggaggatgcggagccc U34038 Human proteinase-activated receptor-2 mRNA, complete cds. cggggcccaagaaccatgtctacgcg U34044 Human selenium donor protein (selD) mRNA, complete cds. tcggagcccggctggatgttacaggc U34046 Human transcription factor PU.1 (Spi-1) gene, promoter region and gccccgctctgcaggatgggcacagt U34051 Human cyclin-dependent kinase 5 activator isoform p39i mRNA, aactctaactcccccatggagtcggc U34070 Human CCAAT/enhancer binding protein alpha gene, complete cds. cttcaagcctccaggatggcaatcca U34074 Human A kinase anchor protein S-AKAP84 mRNA, nuclear gene encoding tcctgacttgggaccatggtgattct U34227 Human myosin-VIIa mRNA, partial cds. ggggaaggcaccgtgatgcccgcaac U34249 Human putative zinc finger protein (ZNFB7) mRNA, complete cds. tctcctgtcgccgccatgagcactgg U34252 Human gamma-aminobutyraldehyde dehydrogenase mRNA, complete cds. aacccagggagcgcgatgggctgcag U34279 Human uroguanylin mRNA, complete cds. atcgttccatttacaatggcgcagag U34304 Human nonmuscle myosin heavy chain IIB mRNA, partial cds. atactactgaaatgaatgggcaaaaa U34343 Human 13kD differentiation-associated protein mRNA, partial cds. tccagaggcagggctatgctcacatt U34349 Human seven trans-membrane domain protein (AD3LP/AD5) mRNA, aggcagaaggaacccatggctttagc U34355 Human skeletal muscle insulin receptor binding protein (Grb-IR) ctgacacctcccaccatggacagctt U34360 Human lymphoid nuclear protein (LAF-4) mRNA, complete cds. gccgccagaggagaaatgtctgaagt U34584 Human Bcl-2 interacting killer (BIK) mRNA, complete cds. cagagcgctgccatcatgagtgaaat U34605 Human retinoic acid- and interferon-inducible 58K protein RI58 gagacagctccagacatgtggctctt U34623 Human T cell surface glycoprotein CD-6 mRNA, complete cds. gagacagctccagacatgtggctctt U34624 Human T cell surface glycoprotein CD-6 mRNA, complete cds. gagacagctccagacatgtggctctt U34625 Human T cell surface glycoprotein CD-6 mRNA, complete cds. cgaactagtgttgggatggccaccaa U34683 Human glutathione synthetase mRNA, complete cds. tctctcggcagcagaatgagccggca U34690 Human coronin-like protein (HCORO1) mRNA, complete cds. tcaggtgggtgagaaatgggcgactg U34802 Homo sapiens gap junction membrane channel protein alpha-8 (GJA8) ccctgacgcaggaacatggagctgat U34804 Human thermostable phenol sulfotransferase (STP2) gene, partial atctgctctttggtgatggacccaga U34806 Human G protein-coupled receptor (GPR15) gene, complete cds. caagctgtggtatttatgagcctcca U34819 Human JNK3 alpha2 protein kinase (JNK3A2) mRNA, complete cds. caagctgtggtatttatgagcctcca U34820 Human JNK3 alpha1 protein kinase (JNK3A1) mRNA, complete cds. gcaggacgctgcatcatgagcgacag U34821 Human JNK2 alpha1 protein kinase (JNK2A1) mRNA, complete cds. accagagagaacatcatggtggcttt U34844 Human mercurial-insensitive water-channel gene, 5' region and accagagagaacatcatggtggcttt U34845 Human mercurial-insensitive water channel mRNA, form 1, complete ctctggtccacatggatgaggaaaaa U34846 U33013 Human mercurial-insensitive water channel mRNA, form 2, complete aaggaagagaccaagatgaatacaga U34877 Homo sapiens biliverdin-IX alpha reductase mRNA, complete cds. ccccacagtctcaccatggcccgcac U34879 Human 17-beta-hydroxysteroid dehydrogenase (EDH17B2) gene, complete aaggtggccttgcaaatgccggaagg U34880 Homo sapiens DPH2L mRNA, complete cds. gtggtgtccagcaacatggaggccac U34919 Human white homolog (white) mRNA, complete cds. actggcgctgccaccatgttccccag U34962 Human transcription factor HCSX (hCsx) mRNA, complete cds. ttcttaatatctaagatggtgcgtga U34976 Human gamma-sarcoglycan mRNA, complete cds. gcgggactcggcggcatggcgggctc U34994 Homo sapiens DNA dependent protein kinase catalytic subunit (PRKDC) gcaggacgctgcatcatgagcgacag U35002 Human JNK2 beta1 protein kinase (JNK2B1) mRNA, complete cds. gcaggacgctgcatcatgagcgacag U35003 Human JNK2 beta2 protein kinase (JNK2B2) mRNA, complete cds. taattgcttgccatcatgagcagaag U35004 Human JNK1 beta1 protein kinase (JNK1B1) mRNA, complete cds. tttggctgcaattgcatgaaatccca U35048 Human TSC-22 protein mRNA, complete cds. accagagccggcggcatggacttcgt U35100 Human complexin II mRNA, complete cds. gccgccggcccggacatggccgccaa U35113 Human metastasis-associated mta1 mRNA, complete cds. gctgctgccggtgtcatggcggagct U35116 Human ubiquitin isopeptidase T mRNA, complete cds. aatgttggaccccaaatgattataag U35117 Human transcription factor Dp-2 mRNA, partial cds. ccagacggcgcagacatgtcagaaca U35139 Human NECDIN related protein mRNA, complete cds. acgacccgacgcaagatggcgagtaa U35143 Human retinoblastoma-binding protein (RbAp46) mRNA, complete cds. ggactttaaattaaaatggaaaaata U35146 Homo sapiens p56 KKIAMRE protein kinase (KKIAMRE) mRNA, complete cttttcacatccactatgaacacctc U35232 Human neuropeptide Y4 receptor protein gene, complete cds. aggtcgctgccaagcatggcgcccac U35234 Human protein tyrosine phosphatase sigma mRNA, complete cds. tgtcaattcgccgccatgaacgtggt U35246 Human vacuolar protein sorting homolog h-vps45 mRNA, complete cds. ttgcaggcgggaaccatgtctcaggc U35340 Human beta B1-crystallin mRNA, complete cds. cctggaagcctagaaatgggaccatt U35376 Human repressor transcriptional factor (ZNF85) mRNA, complete cds. ccttcaggcccaaagatggggaacat U35398 Human G protein-coupled receptor mRNA, complete cds. gccgaagtgcccaccatgggcaacca U35399 Human G protein-coupled receptor mRNA, complete cds. aagctggcgggcactatggggaaaaa U35451 Homo sapiens heterochromatin protein p25 mRNA, complete cds. caaagaacatccaccatgcagctctt U35464 Human protein C inhibitor (PCI-B) mRNA, complete cds. cgcctggtgggcagcatgtcggcaac AJ001340 Homo sapiens mRNA for U3 snoRNP associated 55 kDa protein. ccgggcccaggcgcgatggtgcagca U35612 Homo sapiens SOX22 protein (SOX22) mRNA, complete cds. gaggaaggagagaaaatggcgtccac U35622 Homo sapiens EWS protein/E1A enhancer binding protein chimera mRNA, gaggaagagatagccatggaggacag U35735 Human RACH1 (RACH1) mRNA, complete cds. cgtggttgtcccgccatggcactgtc U35832 Human anthracycline-associated resistance ARX mRNA, complete cds. gactgatctgccgccatgattggagg U36188 Human clathrin assembly protein 50 (AP50) mRNA, complete cds. actaagattctcaaaatggtgtatta U36189 Human p311 protein (hP311) mRNA, complete cds. ccgggcgcaccgaccatggcctccaa U36190 Human cysteine-rich protein 2 (hCRP2) mRNA, complete cds. tgcatgcctcaccttatggaaaggat U36221 Human pancreatic zymogen granule membrane protein GP-2 mRNA, ggacctgtactgaaaatgggtccaat U36269 Human neuropeptide Y/peptide YY Y2 receptor mRNA, complete cds. accatcccccctgccatgtgggaact U36308 Homo sapiens lens major intrinsic protein (MIP) gene, complete cds. tcgtcaggctaagaaatggcatttca U36310 Human glycerol-3-phosphate dehydrogenase mRNA, nuclear gene ctgctctgcggggtcatggtgtgctt U36336 Human lysosome-associated membrane protein-2b (LAMP2) mRNA, cagtcaatatgcaccatgtttaatgt U36448 Human Ca2+-dependent activator protein for secretion mRNA, complete tcctaggccaagctcatggcccagca U36499 Human lymphoid-specific SP100 homolog (LYSP100-A) mRNA, complete tcctaggccaagctcatggcccagca U36500 Human lymphoid-specific SP100 homolog (LYSP100-B) mRNA, complete gcctagggtgggaagatggcaggtgg U36501 Human SP100-B (SP100-B) mRNA, complete cds. gtctcggaggccaggatgcctgccct U36600 Homo sapiens heparan N-deacetylase/N-sulfotransferase-1 mRNA, cttcctccccccgccatgctccagtt U36601 Homo sapiens heparan N-deacetylase/N-sulfotransferase-2 mRNA, tagcgcggctcagccatgagcaacag U36623 Human tyrosine phosphatase epsilon cytoplasmic isoform (PTPRE) ccttccgagtgggccatggccggtac U36759 Human pre-T cell receptor alpha-type chain precursor, mRNA, cgcgtcaccgccgggatgaagccgat U36764 Human TGF-beta receptor interacting protein 1 mRNA, complete cds. acactgtttccagccatgggtttgtc U36787 Human putative holocytochrome c-type synthetase mRNA, complete cds. gcggcggcggccgggatgatgctgct U36926 Human lanosterol 14-alpha-demethylase (CYP51P1) processed gcccgggttggcgccatgtacgccgt U37012 Human cleavage and polyadenylation specificity factor mRNA, agcccaccggccagcatgtcctctgc U37019 Homo sapiens smooth muscle cell calponin mRNA, complete cds. tcccttgatctgagaatggctacctc U37022 Human cyclin-dependent kinase 4 (CDK4) gene, complete cds. cctccagccagaaggatggggtggct U37055 M74179 Human hepatocyte growth factor-like protein gene, complete cds. atttctgcaccaaccatggccacgtt U37100 Homo sapiens aldose reductase-like peptide mRNA, complete cds. gggcaccagccagccatggccacagc U37106 Human erythroid Kruppel-like factor EKLF gene, complete cds. ccacagacttaaaacatgagctcaga U37122 Human adducin gamma subunit mRNA, complete cds. ttcccgaatctcagaatgcctgttaa U37139 Human beta 3-endonexin mRNA, long form and short form, complete cataatctcttctagatggaggcatg U37146 Human silencing mediator of retinoid and thyroid hormone action cgccgccgctccgccatggggaagcg U37219 Human cyclophilin-like protein CyP-60 mRNA, complete cds. tgggcttttcacaaaatggcgccgaa U37230 Human ribosomal protein L23a mRNA, complete cds. aagcggatcgaagtgatggccctgcc U37248 Homo sapiens alpha-mannosidase (6A8) mRNA, complete cds. cctacaggaggaagaatggctgcagg U37251 Human KRAB zinc finger protein (ZNF177) mRNA, splicing variant, cctacaggaggaagaatggctgcagg U37263 Human KRAB zinc finger protein (ZNF177) mRNA, complete cds. aacaccatagacaatatgtcgctctt U37283 Human microfibril-associated glycoprotein-2 MAGP-2 mRNA, complete aaagcgggcagcaggatggtggtgga U37352 Human protein phosphatase 2A B'alpha1 regulatory subunit mRNA, tgactgaccataaaaatgagtactgc U37359 Homo sapiens MRE11 homologue hMre11 mRNA, complete cds. cgctcgcgcctctcgatgggcagctc U37408 Homo sapiens phosphoprotein CtBP mRNA, complete cds. ttggcggggaccgtcatggcgtcgca U37426 Human kinesin-like spindle protein HKSP (HKSP) mRNA, complete cds. accgccgtgggaacgatggcagatga U37448 Human Mch3 isoform alpha (Mch3) mRNA, complete cds. gatcagccttgtgggatggcagatga U37449 Human Mch3 isoform beta (Mch3) mRNA, complete cds. gactctgacaggatcatggctatgat U37518 Human TNF-related apoptosis inducing ligand TRAIL mRNA, complete aaccttcaggcctggatgaaggatga U37519 Human aldehyde dehydrogenase (ALDH8) mRNA, complete cds. gtcgcaaaatccaacatgaaaatcct U37529 Human substance P beta-PPT-A mRNA, complete cds. cccattcatttcattatgaacatagt U37546 Human IAP homolog C (MIHC) mRNA, complete cds. tactgtcacctactcatgcacaaaac U37547 Human IAP homolog B (MIHB) mRNA, complete cds. ttggaacagaaagaaatggatttatc U37574 Human BRCA1 gene, partial cds. atttccagctcagcgatgcccccagg U37591 Human nmd mRNA, complete cds. ctccctggccgccccatgtcggccgc U37673 Human neuron-specific vesicle coat protein and cerebellar cgtggccccctcgcgatggcgggcat U37689 Human RNA polymerase II subunit (hsRPB8) mRNA, complete cds. ggtgacaacgccagcatgccagtgct U37707 Human dlg3 mRNA, complete cds. tcgtctggtgggaccatgaactgcca U37791 Homo sapiens clone rasi-1 matrix metalloproteinase RASI-1 mRNA, tttttgaaaaatacaatgtctaatgg U38175 Human HuR RNA binding protein (HuR) mRNA, complete cds. agtgccctccccacaatggggcagat U38226 Human testis-specific hexokinase 1 (hHK1-ta) mRNA, partial cds. agtgccctccccacaatggggcagat U38227 Human testis-specific hexokinase 1 (hHK1-tb) mRNA, partial cds. agtgccctccccacaatggggcagat U38228 Human testis-specific hexokinase 1 (hHK1-tc) mRNA, partial cds. gaagaagaagaaaacatgtcaggaca U38260 Human islet cell autoantigen ICAp69 mRNA, complete cds. taggcccctcccacaatgcttgtcgc U38276 Human semaphorin III family homolog mRNA, complete cds. cccactctgcccaccatggacggcgt U38291 Human microtubule-associated protein 1a (MAP1A) genomic sequence. tagaacctaacctggatgcagctctc U38320 Homo sapiens clone rasi-3 matrix metalloproteinase RASI-1 mRNA, tcgtctggtgggaccatgaactgcca U38321 Homo sapiens clone rasi-11 matrix metalloproteinase RASI-1 mRNA, ctgaggcctggacaaatgggagtgac U38322 Homo sapiens clone rasi-9 matrix metalloproteinase RASI-1 mRNA, gccacaagggcccgcatgaggcagcc U38431 Human clone rasi-6 matrix metalloproteinase RASI-1 mRNA, splice aactgacgagtaaacatgtatggaaa U38480 Human retinoid X receptor-gamma mRNA, complete cds. ctgtccaaagttaacatgtcactgaa U38545 Human ARF-activated phosphatidylcholine-specific phospholipase D1a tcctatcagagcaacatgaattctgc U38613 Human mariner transposon humar1pcr. ccttatcaaagcaacatgaattctgc U38614 Human mariner transposon humar1g2. ccctattagaacaacataaattctgc U38615 Human mariner transposon humar1g1. actgagttcttcattatgtctgatgg U38654 Homo sapiens Rab27a mRNA, complete cds. ctcctgcacaagaacatgaaacacct U38663 Human IgG anti-platelet GPIIb/IIIa antibody heavy chain (ha4g1) gaagccaccgtcatcatgtctgacca U38784 Human ubiquitin-like protein mRNA, complete cds. cgagggactttgaacatgtcggggat U38785 Human RAD6 homolog mRNA, complete cds. ccaggacttcaagccatgtgggtctt U38805 Homo sapiens fertilin beta mRNA, complete cds. gatctctgccccaacatgattgcggc U38810 Human mab-21 cell fate-determining protein homolog (CAGR1) mRNA, ttcccatcggcgaagatggccctgga U38817 Human SUPT4H mRNA, complete cds. ttcccatcggcgaagatggccctgga U38818 Human SUPT4H mRNA, complete cds. ccagcaggtggggtcatgatcaaaca U38864 Human zinc-finger protein C2H2-150 mRNA, complete cds. gaacaacctgtgtgcatgctttttga U38894 Human protein tyrosine kinase t-Ror1 (Ror1) mRNA, complete cds. gacttcctggccaacatgaggtttct U38904 Human zinc finger protein C2H2-25 mRNA, complete cds. gcctgcggggcggagatgggcagggg U38945 Human hypothetical 18.1 kDa protein (CDKN2A) mRNA, complete cds. acctggtacatcggcatggcgcaacc U38964 Human PMS2 related (hPMSR2) gene, complete cds. ccgggcctggcccgtatgtgtccttg U38979 Human PMS2 related (hPMSR3) gene, complete cds. gcctgccttcttgccatgtctaacga U39050 Human mitogen-responsive phosphoprotein (DOC-2) mRNA, complete cds. gacctggagcctataatggaactggg U39064 Human MAP kinase kinase 6 mRNA, complete cds. aaaggaaaggggaaaatgtctcagtc U39065 Human MAP kinase kinase 6b mRNA, complete cds. cgcgtcacagccgggatgaagccgat U39067 Homo sapiens translation initiation factor eIF3 p36 subunit mRNA, aacaacatcccagctatggctggcga U39195 Human clone KGP G-protein coupled inwardly rectifying potassium tcgccccttcgtattatgtctgcact U39196 Human clone hGIRK1 G-protein coupled inwardly rectifying potassium tcctgacttgggaccatggtgattct U39226 U17180 Human myosin VIIA (USH1B) mRNA, complete cds. ttcgccgccctcacgatgactacctc U39231 Human GIP receptor (GIPR) mRNA, complete cds. tcaccgcatcacaccatggctctgaa U39317 Human E2 ubiquitin conjugating enzyme UbcH5B (UBCH5B) mRNA, cgacaagcacacactatggcgctgaa U39318 Human E2 ubiquitin conjugating enzyme UbcH5C (UBCH5C) mRNA, tagaaggggaaactgatgccaggaga U39360 Homo sapiens DNA-binding protein (CROC-1A) mRNA, complete cds. ctgccgctgctaaacatggcctacaa U39361 Homo sapiens DNA-binding protein (CROC-1B) mRNA, complete cds. gagggacacgcatgcatggggctggt U39402 Human fetal brain (199G4) mRNA, complete cds. ccctttgtggccgccatggacaattc U39412 Homo sapiens alpha SNAP mRNA, complete cds. cctcttcgtgggaaaatgaaccagaa U39447 Human placenta copper monamine oxidase mRNA, complete cds. ccccaacctgtgacaatgacagcaga U39487 Human xanthine dehydrogenase/oxidase mRNA, complete cds. tcgtcgcgcagggtgatggctcgcgc U39550 Homo sapiens UDP-glucuronosyltransferase (UGT1J) gene, exon 1, ggctgaagttctctgatggctcctgc U39551 Human UDP-glucuronosyltransferase (UGT1K) pseudogene, exon 1, ggctgaagttctctgatggcttctgc U39552 Human UDP-glucuronosyltransferase (UGT1L) pseudogene, gene, exon 1, ggctgaagttctctgatggctcgtgc U39570 Human UDP-glucuronosyltransferase (UGT1G) gene, exon 1, partial aggcactgggcagtgatgagggtcct U39573 Human salivary peroxidase mRNA, complete cds. ccagaagggtgggagatggcagtttt U39576 Human butyrophilin precursor mRNA, complete cds. aaaggaaaggggaaaatgtctcagtc U39656 Human MAP kinase kinase 6 (MKK6) mRNA, complete cds. aaaggaaaggggaaaatgtctcagtc U39657 Human MAP kinase kinase 6 (MKK6) mRNA, complete cds. ggcacgagcttcagcatgactactca U39664 Homo sapiens Tiff66 mRNA, complete cds. tttccttgtaggcaaatgtgcaatac U39736 Human p53-associated protein (mdm2) gene, 5' end, and partial cds. ctgcgtgcgaggattatggctgctgt U39817 Human Bloom's syndrome protein (BLM) mRNA, complete cds. cagggtggctccaggatgttaggaac U39840 Human hepatocyte nuclear factor-3 alpha (HNF-3 alpha) mRNA, agtccggccatcaccatgctccggac U39905 Human vesicular monoamine transporter VMAT1 mRNA, complete cds. gagacttcggcggacatggctcccag U39945 Human adenylate kinase 2 (adk2) mRNA, complete cds. gtgagggaaataacaatggagccagg U40002 Human hormone-sensitive lipase testicular isoform mRNA, complete gggacagcagccacaatgaggaactc U40006 Human granzyme A gene, upstream sequence and partial cds. aggcactttggaagaatgactctgga U40038 Human GTP-binding protein alpha q subunit (GNAQ) mRNA, complete gcggcggcggcggggatgatgttgct U40053 Human lanosterol 14-alpha demethylase (CYP51P2) processed ttggagccggaagccatggcacacta U40152 Human origin recognition complex 1 (HsORC1) mRNA, complete cds. agccctttaagccagatgatgaactt U40215 Human synapsin IIb mRNA, complete cds. atctccaggggggccatggccagtac U40223 Human uridine nucleotide receptor (UNR) gene, complete cds. aaaaggttggcaacaatgagtaaacc U40268 Homo sapiens origin recognition complex 2 homolog (Orc2) mRNA, cctgagcccgccgcgatgggagctgc U40271 Homo sapiens transmembrane receptor precursor (PTK7) mRNA, complete ctctcactttccgtcatggcgctgaa U40272 Human NAD+-specific isocitrate dehydrogenase gamma subunit accgccgtgggaacgatggcagatga U40281 Human cysteine protease CMH-1 mRNA, complete cds. cgccgggacgctgctatggacgacat U40282 Homo sapiens integrin-linked kinase (ILK) mRNA, complete cds. gggtcgctgccaagcatggcgcccac U40317 Human protein tyrosine phosphatase PTPsigma (PTPsigma) mRNA, gccgccagtgtcgacatgctgctgga U40343 Human CDK inhibitor p19INK4d mRNA, complete cds. gcaccagtggccagaatgtccacgca U40347 Human serotonin N-acetyltransferase mRNA, complete cds. aagcaaaagacgaaaatggctaaatt U40369 Human spermidine/spermine N1-acetyltransferase (SSAT) gene, ttcgctccggacaccatggacaagtt U40373 Human cell surface glycoprotein CD44 mRNA, complete cds. gcaccagtggccagaatgtccacgca U40391 Human serotonin N-acetyltransferase gene, complete cds. gacactaattctggaatgtcaattcc U40396 Human steroid receptor coactivator (SRC-1) mRNA, complete cds. ggatctacacagaccatggccttgca U40434 Human mesothelin or CAK1 antigen precursor mRNA, complete cds. cataacctgaggaccatggatgctga U40462 Human Ikaros/LyF-1 homolog (hIk-1) mRNA, complete cds. ggaactcatatcaacatggcaaacct U40490 Human nicotinamide nucleotide transhydrogenase mRNA, nuclear gene ggctcggaggcgaagatggcgtccgg U40571 Human alpha1-syntrophin (SNT A1) mRNA, complete cds. ggctgcctgactggaatgagggtagc U40572 Human beta2-syntrophin (SNT B2) mRNA, complete cds. gccggctataggcgcatggaaggttc U40579 Human deoxyhypusine synthase mRNA, complete cds. ctgaggtattaagaaatggagagaaa U40622 Human XRCC4 mRNA, complete cds. cagtccactgctctgatgccgaaggg U40623 Human subtilisin-like protease PC8 precursor (PC8) mRNA, complete agtggcccctgtgagatggctgagca U40671 Human DNA ligase III mRNA, complete cds. atcgagccatttaacatggcggagga U40705 Homo sapiens telomeric repeat binding factor (TRF1) mRNA, complete ttaagtattggagccatgggaataaa U40763 Human Clk-associated RS cyclophilin CARS-Cyp mRNA, complete cds. cgcaggactgagaccatggaggcggt U40846 Human alpha-N-acetylglucosaminidase (NAG) mRNA, complete cds. ccgggggtcgcgggtatggccgaggc U40847 Human Treacher Collins syndrome (TCOF1) mRNA, complete cds. cccctggccgagatcctgagcgtgaa U40989 Human tat interactive protein mRNA, complete cds. ttcaaggcattcgaaatggggaaaga U40992 Homo sapiens heat shock protein hsp40 homolog mRNA, complete cds. cggccccgcaaggccatgaaggtgaa U40998 Human retinal protein (HRG4) mRNA, complete cds. ggagacgaaggcgcaatggcgaggaa U41060 Homo sapiens estrogen regulated LIV-1 protein (LIV-1) mRNA, gtcctcccgacggccatgaacactac U41070 Human P2 purinergic receptor mRNA, complete cds. ctagtcgcggacgcaatggcttcaag U41284 Homo sapiens cytochrome c oxidase (COX5B) gene, partial cds. ttcaaggcattcgaaatggggaaaga U41290 Human DNAJ homolog (DNAJW) gene, complete cds. ggtggaacagcaatcatgactgttgg U41303 Human small nuclear ribonuleoprotein particle N (SNRPN) mRNA, gtgggataagcagtaatggcggaggc U41315 Human ring zinc-finger protein (ZNF127-Xp) gene and 5' flanking caacattaggagtaggagcggcagtt U41316 Human ZNF127-Xq pseudogene. cacctccaggccactatggcgcctgg U41371 Human spliceosome associated protein (SAP 145) mRNA, complete cds. gtccgtgcctccaagatggtgagtct U41448 Homo sapiens ribosomal protein S26 (RPS26) gene, complete cds. tcagcaggcaaaaagatgccagtaat U41492 Homo sapiens clone HTG-5 photoreceptor transducin gamma subunit ttgacttaaagtgccatgagaaaatt U41514 Human UDP-GalNAc:polypeptide N-acetylgalactosaminyltransferase gcgcggacagtcgagatgtcagagaa U41515 Human deleted in split hand/split foot 1 (DSS1) mRNA, complete cds. aagccccctgccagcatggccagcga U41517 Human channel-like integral membrane protein (AQP-1) mRNA, clone gaaggggaacgaaagatggcggcgga U41635 Human OS-9 precurosor mRNA, complete cds. gttcatcttctcaccatgaggctccc U41643 Human germline Ig kappa V region IGKV (allele VkA2b) gene, complete gttcatcttctcaccatgaggctccc U41644 Human germline Ig kappa V region IGKV (allele VkA2c) gene, complete gttcatcttctcaccatgaggctccc U41645 Human germline Ig kappa V region IGKV (allele VkA18b) gene, gtgccccggcgggtgatgccaaatac U41654 Human adenovirus protein E3-14.7k interacting protein 1 (FIP-1) tgaatcgtgggtgggatggccgcggg U41668 Human deoxyguanosine kinase mRNA, complete cds. gggtcgctgccaagcatggcgcccac U41725 Human protein tyrosine phosphatase PTPsigma-(brain) (PTPsigma) tacgtacgctgcgccatgttcaagaa U41740 Human trans-Golgi p230 mRNA, complete cds. gcgtgccgccacccgatggaagattc U41742 Human nucleophosmin-retinoic acid receptor alpha fusion protein gcgtgccgccacccgatggaagattc U41743 Human nucleophosmin-retinoic acid receptor alpha fusion protein cgcggcggcgcctcaatgcctaaagg U41745 Human PDGF associated protein mRNA, complete cds. ggtcccgcaccagccatggcgcagat U41763 Human muscle specific clathrin heavy chain (CLTD) mRNA, complete gcggaatcggccgagatggggtctgg U41766 Human metalloprotease/disintegrin/cysteine-rich protein precursor cagagggtgacccggatgatggcggc U41804 Human putative T1/ST2 receptor binding protein precursor mRNA, ccctcgccgctcgctatggcgtcgct U41806 Human EBI3-associated protein p60 mRNA, complete cds. agactcattttgaagatgtttaacaa U41815 Human nucleoporin 98 (NUP98) mRNA, complete cds. gggctgtaactggagatggaattccg U41843 Human Dr1-associated corepressor (DRAP1) mRNA, complete cds. gtcgaggaggagagaatgaccgaggt U42029 Human P2Y1 purinoceptor mRNA, short form, complete cds. gtcgaggaggagagaatgaccgaggt U42030 Human P2Y1 purinoceptor mRNA, long form, complete cds. ccccacctcgccgccatgcgcctccg U42068 Human liver endoplasmic reticulum P58 mRNA, complete cds. ggcccgagccgtcggatgcccgcgcg U42217 Human N-methyl purine DNA-glycosylase (MPG) gene, partial cds. cactgccctgccgcgatgggggcccg U42349 Human N33 mRNA, complete cds. ctcaatgcaaacactatgcggagagc U42361 Human protein tyrosine phosphatase Cr1PTPase precursor (Ch-1PTPase gccatcctctccagaatgaagatctt U42376 Human retinoic acid induced RIG-E precursor (E) mRNA, complete cds. cttttcacatccactatgaacacctc U42387 Human pancreatic polypeptide receptor mRNA, complete cds. ggacctgtactgaaaatgggtccaat U42389 human neuropeptide y/peptide YY receptor type 2 mRNA, complete cds. cgaaaaaacgatgaaatgaaagctat U42390 Homo sapiens Trio mRNA, complete cds. cggggctcctgcagcatggctgtcag U42408 Human ladinin (LAD) mRNA, complete cds. cgggcgcctcttgcaatggagacggt U42412 Human 5'-AMP-activated protein kinase, gamma-1 subunit mRNA, ctgcccccagtgaatatggtgaagaa U42600 Human calcium-activated potassium channel beta subunit mRNA, ggctgcagttctctcatggctcgcac U42604 Human UDP-glucuronosyltransferase (UGT1H), exon 1. cctggaaaggacaccatgagcactga U42625 Human tumor necrosis factor alpha (TNFA) gene, allele TNFAp4, ggacctgtactgaaaatgggtccaat U42766 Human neuropeptide y2 receptor mRNA, complete cds. cagccaggggccagcatgagccggag U43030 Homo sapiens cardiotrophin-1 (CTF1) mRNA, complete cds. aggcactttggaagaatgactctgga U43083 Human G alpha-q (Gaq) mRNA, complete cds. cccggtccttccaccatgcacttgct U43142 Human vascular endothelial growth factor related protein VRP mRNA, gcgcagcggccggagatgcagcgggg U43143 Human receptor tyrosine kinase Flt4 (short form) mRNA, complete attggagaagaggctatgtttaatcc U43148 Human patched homolog (PTC) mRNA, complete cds. cttctctgaagtaagatgatttgtca U43168 Human leptin receptor (Ob-r) mRNA, complete cds. accaggtgaacggccatggcgggctg U43185 Human signal transducer and activator of transcription Stat5A mRNA, cctcagggaataacaatgacatcagc U43188 Human Ets transcription factor (NERF-2) mRNA, complete cds. agccccgggataaacatggcgacgtc U43189 Human Ets transcription factors NERF-1a and NERF-1b (NERF-1a,b) gcgcagcgaagcccgatgtggtccgg U43203 Human thyroid transcription factor 1 (TTF-1) mRNA, complete cds. aaagtgaacgccgccatgaaaagaca U43279 Human nucleoporin nup 36 mRNA, complete cds. tgccgggcaggcgccatggcggaagc U43286 Homo sapiens selenophosphate synthetase 2 (SPS2) mRNA, complete aggactgggcacagcatgagatccaa U43292 Human MDS1B (MDS1) mRNA, complete cds. gggagggagggggcgatggctcggcc U43318 Human putative transmembrane receptor (frizzled 5) mRNA, complete ctttgggctataaagatgaagagtct U43328 Human link protein mRNA, complete cds. cccgccctgcgcgccatgaacgcccc U43341 Human transcription factor NFAT1 isoform B (NFAT1) mRNA, complete cccgccctgcgcgccatgaacgcccc U43342 Human transcription factor NFAT1 isoform C (NFAT1) mRNA, complete gccccggcgggcaccatgagccctct U43370 Human VEGF related factor (VRF) gene, partial cds. ggagccgctgccgctatggatgatcg U43399 Human 14-3-3 protein epsilon isoform mRNA, complete cds. actccttctccagacatgcttcccga U43408 Human tyrosine kinase (Tnk1) mRNA, complete cds. ttggagccggaagccatggcacacta U43416 Human replication control protein 1 (PARC1) mRNA, complete cds. ggagccgctgccgctatggatgatcg U43430 Human epsilon isoform 14-3-3 protein mRNA, complete cds. ttttcccgcgccgccatggagatggc U43431 Human DNA topoisomerase III mRNA, complete cds. gtttttatgcaacctatggtcatgca U43519 Human dystrophin-related protein 2 (DRP2) mRNA, complete cds. ctgctgcctgagaggatgtctggggt U43522 Human cell adhesion kinase beta (CAKbeta) mRNA, complete cds. gctcttctcaccaagatgaactcact U43527 Human malignant melanoma metastasis-suppressor (KiSS-1) gene, mRNA, acttgggctccagctatgtggctgcc U43559 Human 11-cis retinol dehydrogenase mRNA, complete cds. cgcaggactgagaccatggaggcggt U43572 Human alpha-N-acetylglucosaminidase (NAGLU) gene, complete cds. atcctgggaaggaaaatgcattgggg U43653 Human obese protein (ob) mRNA, complete cds. agcagaatccaaaccatgaattgtag U43672 Human putative transmembrane receptor IL-1Rrp mRNA, complete cds. gacccttttcacaagatggcgccgaa U43701 Human ribosomal protein L23a mRNA, complete cds. atatcgtaggtaaaaatgcctattgg U43746 Human breast cancer susceptibility (BRCA2) mRNA, complete cds. cagacccggagcagcatgtggactct U43747 Human frataxin (FRDA) mRNA, complete cds. cgccccgcgggggccatggatggtga U43784 Human mitogen activated protein kinase activated protein kinase-3 ctccccagagacaccatgattcctgg U43842 Homo sapiens bone morphogenetic protein-4 (hBMP-4) gene, complete cgagacgcgcgcaccatgagcggtgg U43885 Human Grb2-associated binder-1 mRNA, complete cds. gggctggaggtcgccatggggcgagg U43895 Homo sapiens hepatocyte growth factor-regulated tyrosine kinase cggcacgcagcggagatgcctctttt U43899 Human signal transducing adaptor molecule STAM mRNA, complete cds. agggaaactttcacaatgtccggagc U43901 Homo sapiens 37 kD laminin receptor precursor/p40 ribosome ttcccatcggcgaagatggccctgga U43923 Human transcription factor SUPT4H mRNA, complete cds. gttttgagtctagaaatgaatttaag U43965 Human ankyrin G119 (ANK3) mRNA, complete cds. cgagtccggggcacgatgtccgacgc U44059 Human thyrotroph embryonic factor (TEF) mRNA, complete cds. aataaccgtccagtgatgcctgacca U44060 Human homeodomain protein (Prox 1) mRNA, complete cds. gaaaaacttgaacaaatggacaatat U44378 Human homozygous deletion target in pancreatic carcinoma (DPC4) taaagacaaaaaaaaatggaggaatc U44388 Homo sapiens 60-kD SS-A/Ro ribonucleoprotein gene, exon 2 region gggaaaaagaaagaaatgggaaacag U44403 Human Src-like adapter protein mRNA, complete cds. tcgaagtcagccaccatggaggcgca U44427 Human D53 (hD53) mRNA, complete cds. ctctttctgagcggcatgaagccacc U44755 Human PSE-binding factor PTF delta subunit mRNA, complete cds. ggtagcgcttgcagcatggctgacca U44758 Human calmodulin 2 (CALM2 P4) pseudogene. acagcgttgcagaacatgaacgattg U44798 Human U1-snRNP binding protein homolog mRNA, complete cds. agctttgcagagaacatgaacgattg U44799 Human U1-snRNP binding protein homolog mRNA, complete cds. gggcagttgatcatcatggagacccg U44839 Human putative ubiquitin C-terminal hydrolase (UHX1) mRNA, complete gaaaggtggctgaaaatggtgcagaa U44888 Human myocyte-specific enhancer factor 2A MEF2A pseudogene. ctctttctgagcggcatgaagccacc U44898 Human SNAP45 subunit mRNA, complete cds. tgatgaattggaaccatggtgcaaaa U44953 Homo sapiens DENN mRNA, complete cds. gcacacccggggaccatgggctccat U45285 Human specific 116-kDa vacuolar proton pump subunit (OC-116KDa) cgagggactttgaacatgtcggggat U45328 Human ubiquitin-conjugating enzyme (UBE2I) mRNA, complete cds. ctctcgctgtgagacatgtctgagac U45432 Human ETV6 gene, promoter region and partial cds. cccagccggcccaccatggcacggcg U45448 Human P2x1 receptor mRNA, complete cds. cccattcatttcattatgaacatagt U45878 Human inhibitor of apoptosis protein 1 mRNA, complete cds. tactgtcacctactcatgcacaaaac U45879 Human inhibitor of apoptosis protein 2 mRNA, complete cds. tattttcaagagaagatgacttttaa U45880 Human X-linked inhibitor of apotosis protein XIAP mRNA, complete ccccgcgccaccaagatggtcatcca U45945 Human Na,K-ATPase beta 2 subunit (ATP1B2) mRNA, complete cds. ggaggagctgcagagatgtccggcca U45976 Human clathrin assembly protein lymphoid myeloid leukemia (CALM) agccctattcctaacatggctgatga U45982 Human G protein-coupled receptor GPR-9-6 gene, complete cds. ggtcccgctgccttgatggattatac U45983 Homo sapiens CCR8 chemokine receptor (CMKBR8) gene, complete cds. ttttttctgcccacaatgagcggggt U45984 Homo sapiens CCR6 chemokine receptor (CMKBR6) gene, complete cds. ccgtccagcagcaccatgtgggtgac U46010 Human HGF agonist/antagonist mRNA, complete cds. ttccagtttccagacatggctgatgg U46023 Human Xq28 mRNA, complete cds. ccgagagtttccaggatggcttctgc U46024 Homo sapiens myotubularin (MTM1) mRNA, complete cds. ctccgcgccgtcgccatgtcgcggtt U46025 Human translation initiation factor eIF-3 p110 subunit gene, cttgcgctgcccgccatgccaccgcc U46066 Human ferritin pseudogene, complete cds. acggtcccggacgcgatgaccctgaa U46165 Human Rad GTPase gene, complete cds. ggaccggcctatgtcatggaactgcc U46191 Human renal cell carcinoma antigen RAGE-1 mRNA, complete putative ggaccggcctatgtcatggaactgcc U46192 Human renal cell carcinoma antigen RAGE-2 mRNA, complete putative ggaccggcctatgtcatggaactgcc U46193 Human renal cell carcinoma antigen RAGE-3 mRNA, complete putative aaacagtcgagagctatgaattttga U46194 Human renal cell carcinoma antigen RAGE-4 mRNA, complete putative ggacgtcgtcgcgccatggcggagac U46461 Human dishevelled homolog (DVL) mRNA, complete cds. ccctcactgggcagcatgggggagaa U46570 Human tetratricopeptide repeat protein (tpr1) mRNA, complete cds. gagtgcgatgtggtaatggcggcgac U46571 Human tetratricopeptide repeat protein (tpr2) mRNA, complete cds. ccttcagcctccaacatgaaggtctc U46572 Human eotaxin precursor gene, complete cds. ccttcagcctccaacatgaaggtctc U46573 Human eotaxin precursor mRNA, complete cds. ctgcaggaccaggccatggagctcga U46689 Human microsomal aldehyde dehydrogenase (ALD10) mRNA, complete cds. cggcgtgtcaaaaaaatgtcagatga U46691 Human putative chromatin structure regulator (SUPT6H) mRNA, tccgtcgccgccaagatgatgtgcgg U46692 Human cystatin B gene, complete cds. tcattgaattttagaatgattgaaga U46744 Human dystrobrevin-alpha mRNA, complete cds. aactacaaaaccagaatgattgaaga U46745 Human dystrobrevin-beta mRNA, complete cds. gaacctttgcaccccatgttcccaga U46746 Human dystrobrevin-epsilon mRNA, complete cds. agctcgccgctcgctatggcgtcgct U46751 Human phosphotyrosine independent ligand p62 for the Lck SH2 domain ctcttaaccttcaacatgaaagtctc U46767 Homo sapiens monocyte chemoattractant protein-4 precursor (MCP-4) gaaacttctcagagaatgctccaaaa U46768 Human stanniocalcin mRNA, complete cds. cggcactaagcaaatatggacctcgc U46838 Human p105MCM mRNA, complete cds. gctcgcaggccgcggatgaagaagaa U46917 Human Bcl-2 associating athanogene-1 protein (hBAG-1) mRNA, cagagggtgggcaagatggcggcgcc U46920 Human metaxin (MTX) gene, complete cds. ttcaactgtgaggacatgtcgttcag U46922 Human FHIT mRNA, complete cds. ctatcgtcgtcagtcatggctagcat Z82254 Human DNA sequence from clone LL0XNC01-46H11 on chromosome X gcctccgccggcgcgatgggcgaacc U47025 Human fetal brain glycogen phosphorylase B mRNA, complete cds. tgcttctctaggtccatggagggaag U47050 Human putative calcium influx channel (htrp3) mRNA, complete cds. caaaagaagagaaaaatgaagacggg U47054 Human putative mono-ADP-ribosyltransferase (htMART) mRNA, complete gcgggactcggcggcatggcgggctc U47077 Homo sapiens DNA-dependent protein kinase catalytic subunit atattttgcttcgaaatggaaccagc U47105 Homo sapiens H105e3 (H105e3) mRNA, complete cds. gcagtctctgtcaagatgatagaggt U47413 Human cyclin G1 mRNA, complete cds. cgcgtctccggcacgatgaaggattt U47414 Human cyclin G2 mRNA, complete cds. gcccagctgggcctcatgcctctgac U47654 Homo sapiens pyruvate kinase PK-R isoenzyme gene, partial cds; and ttggctgctagagcgatgccgggccg U47674 Homo sapiens putative heart protein PHP mRNA, complete cds. gcgagattgtaaaccatggctgtgtg U47686 Human signal transducer and activator of transcription Stat5B mRNA, cgcgagcaggtgaaaatggctgagaa U47741 Human CREB-binding protein (CBP) mRNA, complete cds. acagaatccttcaccatggtaaaact U47742 Human monocytic leukaemia zinc finger protein (MOZ) mRNA, complete agacccgaggctagcatgggctgcag U47743 Human T cell receptor beta chain (TCRB) mRNA, VDJ region, partial agacccgaggctagcatgggctgcag U47744 Human T cell receptor beta chain (TCRB) mRNA, Vbeta7 region, tgggtccatcatgcaatgctgagcac U47925 Human protein A alternatively spliced form 1 (A-1) mRNA, complete tttgtagcaaaccccatgcacctgca U47926 Human unknown protein B mRNA, complete cds. gctgctgccggtgtcatggcggagct U47927 Human isopeptidase T (ISOT) mRNA, complete cds. ggggctgaggataggatggctcgggg U47928 Human protein A alternatively spliced form 2 (A-2) mRNA, complete ctcgacctgtcagccatgggggagat U47930 Human G-protein beta-3 subunit mRNA, partial cds. gccctgaggcgagacatgggcacctg U48257 Human/HTLV-1 interleukin-9 receptor chimeric mRNA (alternatively gccctgaggcgagacatgggcacctg U48258 Human/HTLV-1 interleukin-9 receptor chimeric mRNA (authentically ggccccctttgcactatgagcaacca U48259 Human T cell receptor beta chain variable region (Vb17) gene, ggccccctttgcactatgagcaacca U48260 Human T cell receptor beta chain variable region (Vb17) gene, tcctgctcctgcaccatgaaagtcct U48263 Human pre-pro-orphanin FQ (OFQ) mRNA, complete cds. ttttaactaaataacatggctcgaat U48296 Homo sapiens protein tyrosine phosphatase PTPCAAX1 (hPTPCAAX1) tttttatttgccataatgaaccgtcc U48297 Homo sapiens protein tyrosine phosphatase PTPCAAX2 (hPTPCAAX2) gatctccggccgtccatgcacagagc U48361 Human NGFI-A binding protein 2 (NAB2) mRNA, complete cds. ccttcaggcccaaagatggggaacat U48405 Human G protein coupled receptor OGR1 gene, complete cds. ccaaggcaccaggacatggatgctga U48408 Human kidney water channel (hKID) mRNA, complete cds. cgccgcctggccgctatggatctatt U48436 Homo sapiens fragile X mental retardation protein FMR2p (FMR2) cgcaagggccgggacatggggcccgc U48437 Homo sapiens amyloid precursor-like protein 1 (APLP1) mRNA, gagggatcaggagctatgggaccaga U48705 Human receptor tyrosine kinase DDR gene, complete cds. cttcggggagcagcgatgcgaccctc U48722 Human epidermal growth factor receptor precursor (EGFR) mRNA, agcgagaggcgcggaatggtggacta U48734 Human non-muscle alpha-actinin mRNA, complete cds. agtctttctgaaggaatgaaagttga U48736 Human serine/threonine-protein kinase PRP4h (PRP4h) mRNA, complete gcagacatggggaccatgaagaccca U48795 Homo sapiens antimicrobial protein CAP18 precursor, gene, complete cggttcccggcgaccatggtgacgat U48807 Human MAP kinase phosphatase (MKP-2) mRNA, complete cds. gcctccctcagcaccatgtaccgagc U48857 Human fumarase mRNA, nuclear gene encoding mitochondrial protein, ccggccccgccggccatgaggcgcgc U48861 Human beta 4 nicotinic acetylcholine receptor subunit mRNA, gggggcgggccggccatgtcccacgg U48865 Human C/EBP epsilon (CEBPE) gene, complete cds. gcgcagccccgggccatgtccgacgc U48869 Human cdk-inhibitor p57/KIP2 (CDKN1C) gene, complete cds. agtcccatcctcgccatggcacccgg U48936 Human amiloride-sensitive epithelial sodium channel gamma subunit gagaagacggtgaccatgggggatgt U48959 Homo sapiens myosin light chain kinase (MLCK) mRNA, complete cds. cagcccggtttggggatgtggtcctt U49065 Human interleukin-1 receptor-related protein mRNA, complete cds. gcacctcgagggaagatggcggacga U49070 Human peptidyl-prolyl isomerase and essential mitotic regulator ggtgtgccctgagccatggaggcgcc U49082 Human transporter protein (g17) mRNA, complete cds. gcttatggtgcagacatggccaagtc U49083 Human cell surface heparin binding protein HIP mRNA, complete cds. gcggggggcagtgccatgcacaagca U49089 Human neuroendocrine-dlg (NE-dlg) mRNA, complete cds. cattgacaatcagccatgtcatccag U49184 Human occludin mRNA, complete cds. ggcaaactgaagaaaatgcacaattt U49187 Human placenta (Diff48) mRNA, complete cds. atcactggcgtcaccatgggggctgt U49188 Human placenta (Diff33) mRNA, complete cds. aaggctatcctcaccatgacccagct U49240 Human symplekin mRNA, complete cds. cgcagtccaggaatcatgctggagaa U49248 Human canalicular multispecific organic anion transporter (cMOAT), tcaggttctagagctatgcagctgga U49250 S78865 Human putative cerebral cortex transcriptional regulator T-Brain-1 tccgaggtcagagtcatggacgagac U49262 Human dishevelled (DVL) mRNA, complete cds. ggtcttttcatgctcatggcggtatt U49283 Human NAD+-specific isocitrate dehydrogenase beta subunit gaaactcttgcacaaatgtacaatac U49349 Human alternatively spliced p85/AS53 mRNA, partial cds. tgccgaattcgcggaatgaagctacc U49352 Human liver 2,4-dienoyl-CoA reductase mRNA, complete cds. tcgtccttggagaagatggaagcgga U49379 Human diacylglycerol kinase epsilon DGK mRNA, complete cds. cagatctgctgagctatgagccaaac U49392 Human allograft inflammatory factor-1 (AIF-1) mRNA, complete cds. ggctgagagcgcgccatggggcaggc U49395 Human ionotropic ATP receptor P2X5a mRNA, complete cds. ggctgagagcgcgccatggggcaggc U49396 Human ionotropic ATP receptor P2X5b mRNA, complete cds. gccgccagtgtcgacatgctgctgga U49399 Human inhibitor of cyclin-dependent kinase 4 d INK4d mRNA, complete cactaataagccaaaatgtctgtcaa U49436 Human translation initiation factor 5 (eIF5) mRNA, complete cds. aagactgaagcaatcatggtgaacct U49516 Human serotonin 5-HT2c receptor mRNA, complete cds. acagggagaagtgaaatgacaacctc U49727 Human C-C chemokine receptor 3 (CKR-3) gene, complete cds. gccgccagaggagaaatgtctgaagt U49730 Homo sapiens apoptosis inducer Nbk mRNA, complete cds. aaaggaaaggggaaaatgtctcagtc U49732 Human MAP kinase kinase MEK6 (MEK6) mRNA, complete cds. cgagtgtgcttagcgatggcctggaa U49740 Human L-isoaspartyl/D-aspartyl O-methyltransferase (PCMT1) gene, acaagggccacagccatgaatggcac U49742 K02281 Human rhodopsin gene, complete cds. gttcctctgcccgccatgccgttcct U49785 Human D-dopachrome tautomerase mRNA, complete cds. atgggagcaaccaccatggaccagaa U49835 Human YKL-39 precursor mRNA, complete cds. cagatagtcttcaagatgccaaactg U49837 Human LIM protein MLP mRNA, complete cds. cctcgcagcctcagcatgggggaaca U49844 Human FRAP-related protein (FRP1) mRNA, complete cds. gggcagctctctggcatgttcctgac U49857 Human transcriptional activator mRNA, complete cds. tcccggggagccagcatgtccactgc U49897 Homo sapiens phenylalanine hydroxylase (PAH) mRNA, complete cds. cagggttcctccaagatggcggcgca U49928 Homo sapiens TAK1 binding protein (TAB1) mRNA, complete cds. caattgattccaacaatgtctcaccc U49957 Human LIM protein (LPP) mRNA, partial cds. gaggagttgcttcttatggatgagca U49973 Human Tigger1 transposable element, complete consensus sequence. ccctatcagagcaacatgaattctgc U49974 Human mariner2 transposable element, complete consensus sequence. gcccactaatccttgatgttcacctt U50040 Human signaling inositol polyphosphate 5 phosphatase SIP-110 mRNA, gaaggataaatcaacatggcaactat U50078 Human guanine nucleotide exchange factor p532 mRNA, complete cds. ggggaggcgagcaagatggcgcagac U50079 Human histone deacetylase HD1 mRNA, complete cds. cacaccgacggtaccatgaaggacga U50136 Human leukotriene C4 synthase (LTC4S) gene, complete cds. gagaaaggtgatgccatgattatgga U50137 Human p38-2G4 mRNA, partial cds. cactccgtcagtgagatggcctccaa U50158 Human cAMP-specific phosphodiesterase HPDE4D2 variant (PDE4D) mRNA, agaagatctgcgaacatgatgcacgt U50159 Human cAMP-specific phosphodiesterase HPDE4D3 variant (PDE4D) mRNA, caggaggcgaagccaatgacgtcagt U50196 Human adenosine kinase mRNA, complete cds. taagattacagcaagatggaaatacc U50315 Human enhancer of zeste homolog 1 (EZH1) mRNA, complete cds. taagtgacagaaggaatggagaccct U50404 Human T cell receptor V-alpha 23 precursor (TCRA) mRNA, partial ctccctgcgaacgagatggccgggac U50410 Human heparan sulphate proteoglycan (OCI5) mRNA, complete cds. gacaaaacaaaagtgatggtcagtat U50523 Human BRCA2 region, mRNA sequence CG037. taggggtagagtaagatgtcttatgg U50532 Human BRCA2 region, mRNA sequence CG005. cggtactcttcagggatgagtcatgt U50553 Homo sapiens helicase like protein 2 (DDX14) mRNA, complete cds. cggtggtgagcggggatggcggttgt U50708 Human branched chain alpha-ketoacid dehydrogenase E1 beta subunit cgtctcgccgccgccatggcggaccc U50733 Human dynamitin mRNA, complete cds. ggttgtcgatggacggtggcggcagc U50743 Human Na,K-ATPase gamma subunit mRNA, complete cds. gtaggaaatcgaaacatgaccaaatc U50822 Human neurogenic helix-loop-helix protein NEUROD (neurod) gene, tcttgataaaaagagatgtgggggga U50839 Homo sapiens g16 protein (g16) mRNA, complete cds. tccagaggcagggctatgctcacatt U50871 Human familial Alzheimer's disease (STM2) gene, complete cds. acgccagtgaccgcgatggtgaactc U50928 Human autosomal dominant polycystic kidney disease type II (PKD2) ctggacaccacaaagatgccacccgt U50929 Human betaine:homocysteine methyltransferase mRNA, complete cds. gcggcaggcgcggccatggcgcagct U50939 Human amyloid precursor protein-binding protein 1 mRNA, complete ttgatctcacagttgatggactgctg U50950 Human infant brain unknown product mRNA, complete cds. tcgccccttcgtattatgtctgcact U50964 Human G protein-activated inwardly rectifying potassium channel aggagcatcagatccatgctgctgct AL021683 Homo sapiens cDNA homologous to Yeast SCO1 & SCO2 genes and ccgtctcgggccaggatgactggagt U51003 Homo sapiens DLX-2 (DLX-2) gene, complete cds. gggaggagaggcgagatggcagatga U51004 Homo sapiens protein kinase C inhibitor (PKCI-1) mRNA, complete gaggaaggtggcaagatggtgttgga U51007 Human 26S protease subunit S5a mRNA, complete cds. gaccccgcggccaccatgtatgtggg U51095 Human homeobox protein Cdx1 mRNA, complete cds. cggaccctcgccaccatgtacgtgag U51096 Human homeobox protein Cdx2 mRNA, complete cds. ctgctggtggtgacaatgtcaaataa U51120 Human protein kinase PAK1 mRNA, complete cds. acagacccctctgccatgaaccagtc U51127 Human interferon regulatory factor 5 (Humirf5) mRNA, complete cds. acgaggcgggacgtcatggaagtgaa U51134 Homo sapiens calcitonin gene-related peptide receptor component cagcggcctcggggaatggaagcgga U51166 Human G/T mismatch-specific thymine DNA glycosylase mRNA, complete aggccggccgcgaagatgccagtggc U51205 Homo sapiens COP9 signalosome subunit 1 CSN1 (CSN1) mRNA, complete ggcggtgctggcaagatggctgcact U51224 Human U2AFBPL gene, complete cds. ggggacggcagcaccatggacccccg U51240 Human lysosomal-associated multitransmembrane protein (LAPTm5) acagggagaagtgaaatgacaacctc U51241 Human eosinophil eotaxin receptor (CMKBR3) gene, complete cds. gtggtttctacaaagatgaaactact U51243 Human alpha-albumin gene, complete cds. gcgggcgctctggtcatggaggactg U51269 Human armadillo repeat protein mRNA, complete cds. ccactgtggaagctcatggactccat U51333 Human hexokinase III (HK3) mRNA, complete cds. ccgcggccgttagtcatgtcggattc U51334 Human putative RNA binding protein (RBP56) mRNA, complete cds. cgcccgaggaggaagatgcagacctt U51336 Human inositol 1,3,4-trisphosphate 5/6-kinase mRNA, complete cds. ggggaaagggcaaggatggtggaggc U51338 Human retina fatty acid binding protein mRNA, complete cds. aagaagcggtagaagatggcgctcac U51432 Homo sapiens nuclear protein Skip mRNA, complete cds. cggggctagggccggatggagccgcg U51477 Human diacylglycerol kinase zeta mRNA, complete cds. gtccgcgcgcacaccatgacgaagaa U51478 Human sodium/potassium-transporting ATPase beta-3 subunit mRNA, agccacacagcaaacatgtttgcaaa U51587 Homo sapiens Golgi complex autoantigen golgin-97 mRNA, complete tgcatagaaaatttaatggatgaaga U51625 Human MOP4 mRNA, partial cds. agggccacagcgacaatgacagctga U51626 Human MOP2 mRNA, complete cds. gggatccccgcaaggatgagtgctgc U51678 Homo sapiens small acidic protein mRNA, complete cds. acagcctgaactcagatgtcagcagc U51869 Human proto-oncogene Bcd orf1 and orf2 mRNA, complete cds. tctttaggtgcaataatgaagagttt U51899 Human kappa-casein gene, complete cds. ccggagacgcgcaggatgccacacga U51903 Human RasGAP-related protein (IQGAP2) mRNA, complete cds. cttaaagctgtcaagatggttctagc U51920 Human signal recognition particle (SRP54) mRNA, complete cds. aattctggcggcgagatggacattct U51990 Human hPrp18 mRNA, complete cds. tgtttattttagactatggaaatgat U52077 Human mariner1 transposase gene, complete consensus sequence. ccctgccctgtgaaaatgttggtgct U52100 Human XMP mRNA, complete cds. gcttccactgcagccatgtcactcct U52101 Human YMP mRNA, complete cds. gtggggagcgggccgatgtccagcct U52144 Human isocitrate dehydrogenase mRNA, complete cds. cctgacgcggccgccatggcgcagga U52152 Human inwardly rectifying potassium channel Kir3.3 mRNA, complete gaagaaactgcaacaatggccaagct U52153 Human inwardly rectifying potassium channel Kir3.2 mRNA, complete aacaacatcccagctatggctggcga U52154 Human G protein-coupled inwardly rectifying potassium channel cacctcggacccaagatgacgtcagt U52155 Human ATP-dependent inwardly rectifying potassium channel Kir4.1 gcattaaggcccgacatggaaccggg U52191 Human SMCY (H-Y) mRNA, complete cds. atccccaggagcaacatggggcccac U52219 Human melatonin-related receptor mRNA, complete cds. gcattaaggcccgacatggaaccggg U52365 Human SMCY mRNA, partial cds. acttgaaagaagacgatgcatacagg U52373 Human serine/threonine kinase MNB (mnb) mRNA, complete cds. ctgagacctagagtcatggatgtatg U52426 Homo sapiens GOK (STIM1) mRNA, complete cds. acctggtctgggaagatgttctacca U52427 Human RNA polymerase II seventh subunit (rpb-7) gene, complete cds. ccctgcagagcagccatggaggaggt U52428 Human fatty acid synthase gene, partial cds. ctgggcagccatggaatggacaatgg U52464 Human P2 purinoceptor (P2Y6) mRNA, complete cds. acacagagggcagtcatgagtgaggt U52513 Human RIG-G mRNA, complete cds. gccccgagcagcggcatggagtccgt U52518 Human Grb2-related adaptor protein (Grap) mRNA, complete cds. gccgaggagtctaccatggctcaaga U52521 Human arfaptin 1, putative target protein of ADP-ribosylation ggcccggcccgagccatgacggacgg U52522 Human arfaptin 2, putative target protein of ADP-ribosylation cccaatgcctcctgaatgatgccagc U52696 Human adrenal Creb-rp homolog (Creb-rp), complete cds, and tgcccagcctcctgaatgatgccagc U52699 Human tenascin-X (XB) mRNA, RACE clone M1, partial cds. cttcaggcctcctgaatgatgccagc U52700 Human tenascin-X (XB) mRNA, RACE clone N1, partial cds. ccgaaggcctcctgaatgatgccagc U52701 Human adrenal Creb-rp homolog (Creb-rp) and tenascin-X (XB) mRNA, ggccccttgcccaccatgaagggaac U52840 Homo sapiens semaphorin F homolog mRNA, complete cds. ccctgacgcaggaacatggagctgat U52852 Homo sapiens TS PST1 (STP1) gene, complete cds. cttctctgaagtaagatgatttgtca U52912 Human B219/OB receptor isoform HuB219.1 precursor mRNA, complete cttctctgaagtaagatgatttgtca U52913 Human B219/OB receptor isoform HuB219.2 precursor mRNA, complete cttctctgaagtaagatgatttgtca U52914 Human B219/OB receptor isoform HuB219.3 precursor mRNA, complete cggagtctgagggagatggaagttga U52962 Human centrosomal protein kendrin mRNA, complete cds. ccactgttttttaaaatgggagatga U52965 Human putative transcriptional regulator ENX-1 mRNA, complete cds. tgagttagagccaacatgagtgagcg U52969 Human PEP19 (PCP4) mRNA, complete cds. gctgtcctcaccgcaatggcggctgt U53003 Human GT335 mRNA, complete cds. gagcgctggggcagcatgaagtgcct U53174 Human cell cycle checkpoint control protein mRNA, complete cds. agccaccaggaggccatgtcgggtga U53204 Human plectin (PLEC1) mRNA, complete cds. gagcgcctcgtcgacatgagtgatgt U53209 Human transformer-2 alpha (htra-2 alpha) mRNA, complete cds. ctgcacggggtcccgatggacctcaa U53212 Human degenerin channel MDEG mRNA, partial cds. gcccaggggtgcgctatgccgtcggg U53220 Human retinoblastoma-related Rb2/p130 gene, 5' flanking region and actgatcctgagaagatggcgtcggg U53225 Human sorting nexin 1 (SNX1) mRNA, complete cds. gataatggcctcagaatgactgcaag U53328 Human cyclin G mRNA, complete cds. cgtgcgacggccgtgatgaagttcgc U53346 Human PWP2H protein mRNA, complete cds. ccggtgcttcccatcatggtggccga U53347 Human neutral amino acid transporter B mRNA, complete cds. aattctgctccggacatgtcgggccc U53442 Human p38Beta MAP kinase mRNA, complete cds. aagtcttttgctttgatggtggtgga U53445 Human ovarian cancer downregulated myosin heavy chain homolog gcctgccttcttgccatgtctaacga U53446 Human mitogen-responsive phosphoprotein DOC-2 mRNA, complete cds. cagcgcgctccggtcatggagatccc U53447 Homo sapiens PAPS synthase gene, complete cds. ccgcactctgctgctatgagcttcct U53454 Human chloride ion current inducer protein (CLCI) mRNA, complete gtcgttggcgctgtcatggcgggtgt U53468 Homo sapiens NADH:ubiquinone oxidoreductase subunit B13 (B13) mRNA, aggcccacgcccaccatggtcccctg U53470 Human signaling inositol polyphosphate phosphatase SHIP II mRNA, gggccaatcgggactatgaaccggaa U53476 Human proto-oncogene Wnt7a mRNA, complete cds. caggaggcagagaagatgggcatcct U53506 Human type II iodothyronine deiodinase mRNA, complete cds. gtctatcccccgaccatggcgaagct U53784 Human serum aryldialkylphosphatase precursor mRNA, complete cds. cttgcctttacgaccatgttcaaggg U53786 Homo sapiens envoplakin (EVPL) mRNA, complete cds. ctgtaagaaagcaagatgcattttag U53821 Homo sapiens adapt78 protein gene, partial cds. cattgacaatcagccatgtcatccag U53823 Human tight junction protein occludin mRNA, complete cds. tctgctgacagcgtcatggggggcag U53830 Homo sapiens interferon regulatory factor 7A mRNA, complete cds. tctgctgacagcgtcatggggggcag U53831 Homo sapiens interferon regulatory factor 7B mRNA, complete cds. ctggacgtgaccatcatgtacaaggg U53832 Homo sapiens interferon regulatory factor 7C mRNA, complete cds. cagagagttgggggaatggatggaga U53930 Human olfactory receptor 17-30 (OLFR 17-30) gene, complete cds. tgcagattttggaagatggcaaagtt U54558 Homo sapiens translation initiation factor eIF3 p66 subunit mRNA, cgggtgggcgtcaagatgaaggcggc U54617 Human pyruvate dehydrogenase kinase isoform 4 mRNA, complete cds. ccgcccccgagagacatgacttccaa U54644 Human tub homolog mRNA, complete cds. ccctgacgcaggaacatggagctgat U54701 Human phenol sulfotransferase (STP) gene, complete cds. ttgccggctgtcggtatgtcgcgaca U54777 Homo sapiens hMSH6 protein (MSH6) mRNA, complete cds. ggagccgctgccgctatggatgatcg U54778 Human 14-3-3 epsilon mRNA, complete cds. caagagctgaacaagatgcattgtga U54804 Human Has2 mRNA, complete cds. actagtgctgtcattatgaatgtgac U54826 Human mad-related protein MADR1 mRNA, complete cds. ggtaacggggcagagatgtggttcga U54993 Human mitochondrial complex I hMWFE subunit mRNA, nuclear gene cccgggtggaacaagatggattatca U54994 Human CC chemokine receptor 5 (CCR5) mRNA, complete cds. gttcccgtcttggccatggcctcgtt U54996 Human protein ZW10 homolog (HZW10) mRNA, complete cds. gaaaatttgataagcatgagagaaga U54999 Human LGN protein mRNA, complete cds. aacccagggagcgcgatgggctgcag U55058 Human uroguanylin gene, complete cds. gaggcggcgagcgccatggccagtcc U55206 Homo sapiens human gamma-glutamyl hydrolase (hGH) mRNA, complete tcctgacttgggaccatggtgattct U55208 Human myosin VIIa long transcript mRNA, complete cds. tcctgacttgggaccatggtgattct U55209 Human myosin VIIa transcript 2 mRNA, complete cds. atgcagcttaaaataatgccgaaaaa U55258 Human hBRAVO/Nr-CAM precursor (hBRAVO/Nr-CAM) gene, complete cds. agaaaaaaagtgaatatggtttttgc U55312 Human G protein-coupled receptor GPR-NGA gene, complete cds. gagttttgattcatcatggataatct U55936 Human SNAP-23 mRNA, complete cds. tttggttgctgacaaatgtcttttta U56079 Human Y5 receptor mRNA, complete cds. cgtgcgacggccgtgatgaagttcgc U56085 Human periodic tryptophan protein 2 (PWP2) mRNA, complete cds. aaacagtttccagagatggattatcc U56102 Human adhesion molecule DNAM-1 mRNA, complete cds. gcgtggacgcccttcatggcggctga U56386 Human SH3 binding protein 3BP2 (3BP2) mRNA, complete cds. cgagagcagcggaagatgtcggacag U56402 Human chromatin structural protein homolog (SUPT5H) mRNA, complete tctgaggtggccagaatggatttgtg U56417 Human lysophosphatidic acid acyltransferase-alpha mRNA, complete gcgccgggccgggccatggagctgtg U56418 Human lysophosphatidic acid acyltransferase-beta mRNA, complete ctttctgtccccagcatgggcaccag U56438 Human dioxin-inducible cytochrome P450 (CYP1B1) gene, complete cds. tggtgtcctgtcaccatggcgctggc U56602 Human peroxisome biogenesis disorder group 4 gene (PXAAA1) mRNA, cgcctttcagtcaggatgtctgcccg U56725 Human heat shock protein mRNA, complete cds. cagagcagcgccaggatgtcacggga U56814 Human DNase1-Like III protein (DNAS1L3) mRNA, complete cds. tgggccaggccagtcatgctagaacg U56816 Human kinase Myt1 (Myt1) mRNA, complete cds. tcctgaaaaatcaaaatggatttaga U56835 Human B-cell specific transcription factor (PAX-5) gene, exon 1A, gtctggagcgccccgatggaaataca U56836 Human B-cell specific transcription factor (PAX-5) gene, exon 1B, ggccgcagaagcgagatgacgaaggg U56856 Human ribosomal protein L37 (PSANK1) pseudogene. agaccgtggctgagcatggagctgtc U56976 Human calmodulin dependent phosphodiesterase PDE1B1 mRNA, complete taaaagatccaaaaaatgagacttct U56979 Human complement factor H precursor (Cfh) gene, partial cds. ggacctgagctggagatgctggccgg U56998 Human putative serine/threonine protein kinase PRK (prk) mRNA, aacctggtgagccgcatgatctccga AL021708 Homo sapiens partial cDNA homologous to M.musculus JIP-1 gene. ggccttggcggggtcatggggccccc U57001 Human ligand for eph-related receptor tyrosine kinases (EPLG8) atgacatagagggagatgatgtgcga U57029 M94653 Human T-cell leukemia virus enhancer factor (HTLF) mRNA, complete ccgaccctcggctccatggagcccgg U57052 Human Hoxb-13 mRNA, complete cds. catgttaacaagcagatgtcatggca U57057 Human WD protein IR10 mRNA, complete cds. gactctgacaggatcatggctatgat U57059 Homo sapiens Apo-2 ligand mRNA, complete cds. ggctgcgagcacatgatggcgatacg U57091 Human small GTP-binding protein rab22b mRNA, complete cds. attgaagctgtgtaaatgagtatgga U57092 Human small GTP-binding protein rab30. accaagaccatcactatgaccgatgg U57093 Homo sapiens small GTP-binding protein Rab27b mRNA, complete cds. actgagttcttcattatgtctgatgg U57094 Human small GTP-binding protein mRNA, complete cds. ccgcgaacccccaccatgaagcccag U57099 Human APEG-1 mRNA, complete cds. ggcagattcctgtccatgctggagga U57316 Human GCN5 (hGCN5) gene, complete cds. gtgctccggggcggcatgtccgaggc U57317 Homo sapiens p300/CBP-associated factor (P/CAF) mRNA, complete cds. ggagctgagatcaggatgttccgctt U57342 Human myelodysplasia/myeloid leukemia factor 2 (MLF2) mRNA, ctgcacggggtcccgatggacctcaa U57352 Human sodium channel 1 (hBNaC1) mRNA, complete cds. actagtgctgtcattatgaatgtgac U57456 Human transforming growth factor-beta signaling protein-1 (bsp-1) catttggatctcagaatgagcaagga U57592 Human jumonji putative protein (jumonji) mRNA, complete cds. tagcccagcatcactatggtggacgc U57623 Human fatty acid binding protein FABP gene, complete cds. ccggaggccgcctggatggagccgcc U57627 Human fetal brain oculocerebrorenal syndrome (OCRL1) mRNA, complete cgtactgcccgtggcatgagggagcc U57629 Human retinitis pigmentosa GTPase regulator (RPGR) mRNA, complete cagtcgccaagaatcatgaaagtcgc U57645 Human helix-loop-helix proteins Id-1 (ID-1) and Id-1' (ID-1) genes, cgcctccgactcaaaatgcctgtctg U57646 Homo sapiens cysteine and glycine-rich protein 2 (CSRP2) mRNA, aggcccacgcccaccatggtcccctg U57650 Human SH2-containing inositol 5-phosphatase (hSHIP) mRNA, complete cctccacaaggctccatggccaatag U57693 Human TFIID subunits TAF20 and TAF15 mRNA, complete cds. agagaacaacttgtaatggagccttc U57721 Human L-kynurenine hydrolase mRNA, complete cds. gcttttcaggctctaatggctgaaga U57796 Human zinc finger protein (LD5-1) mRNA, complete cds. cccgggtggaacaagatggattatca U57840 Human CC chemokine receptor 5 mRNA, complete cds. aagtaacaacgcaggatgccccctgg U57843 Human phosphatidylinositol 3-kinase delta catalytic subunit mRNA, actccgctgctcgccatgtcttctca U57846 Human ribosomal protein L39 mRNA, complete cds. agaccggaacccaagatggctgcgct U57877 Human integral membrane protein CII-3 mRNA, nuclear gene encoding ctatagggaggaaggatggcacatgg U57911 Human fetal brain (239FB) mRNA, from the WAGR region, complete cds. ggcctgacaggcagcatgggcgacat U57971 Human calcium ATPase isoform 3x/a mRNA, complete cds. tgcccattccatgtcatgtatatctg U58032 Homo sapiens myotubularin related protein 1 (MTMR1) mRNA, partial gagcctgccgccaagatgccggccta U58046 Human p167 mRNA, complete cds. acggcgtgcgtcaccatggcgaccgc U58048 Human metallopeptidase PRSM1 mRNA, complete cds. agaacatccctcacaatgtcgtcaac U58087 Human Hs-cul-1 mRNA, complete cds. cctggaagcccgcgcatgcgccctga U58096 Human testis-specific protein (TSPY) mRNA, complete cds. cccggtccttccaccatgcacttgct U58111 Human FLT4 ligand mRNA, complete cds. aatcaattttggaagatgtcactgaa U58130 Human bumetanide-sensitive Na-K-2Cl cotransporter (NKCC2) mRNA, tccagatttagtaacatggcaaagtt U58192 Human TFDP1P pseudogene, partial cds. ccctcacgcaggcccatggcggcggc U58196 S41456 Homo sapiens interleukin enhancer binding factor 1 mRNA, complete ccctcacgcaggcccatggcggcggc U58197 S41457 Homo sapiens interleukin enhancer binding factor 2 mRNA, complete ccctcacgcaggcccatggcggcggc U58198 Human interleukin enhancer binding factor 3 mRNA, complete cds. agggaccaggtggagatgatgcctca U58331 Human placental delta sarcoglycan mRNA, complete cds. gttaatagtcctaggatggatctgac U58334 Human Bcl2, p53 binding protein Bbp/53BP2 (BBP/53BP2) mRNA, acttgaaagaagacgatgcatacagg U58496 Human mnb protein kinase homolog hp86 (DYRK) mRNA, complete cds. aagctggccaaggatatgggagcaac U58514 Human chitinase precursor (HUMTCHIT) mRNA, exon 1a form, complete ccgcgtccccgcagcatgccgcgccc U58516 Human breast epithelial antigen BA46 mRNA, complete cds. cctaaccgctccgtgatgcctaccaa U58658 Human unknown protein mRNA within the p53 intron 1, complete cds. gcgccctcaggcaccatgctgacccg U58681 Homo sapiens neurogenic basic-helix-loop-helix protein (NeuroD2) ccaggtgcaactgacatgggtgaacc U58766 Human FX protein mRNA, complete cds. cgcgtgccttggcccatggccgccta U58773 Human calcium binding protein mRNA, complete cds. taagcaggcatcaggatgttgggctg U58837 Human cGMP-gated cation channel beta subunit (CNCG2) mRNA, complete agagacaccaacaccatgttctgcac U58855 Homo sapiens soluble guanylate cyclase large subunit (GC-S-alpha-1) gaagaataagctaccatggcagctgt U58856 Human chromosome 17 unknown product mRNA, complete cds. ctgcccaccaggaggatgaaggtctc U58913 Human chemokine (hmrp-2a) mRNA, complete cds. ctgcccaccaggaggatgaaggtctc U58914 Human chemokine (hmrp-2b) mRNA, complete cds. gacgccacccgggccatgggggccgc U58917 Homo sapiens IL-17 receptor mRNA, complete cds. cggcctggccacgggatggcccccaa U58970 Human putative outer mitochondrial membrane 34 kDa translocase cggggctcctgcagcatggctgtcag U58994 Human ladinin (LAD) gene, complete cds. ctgccctggcctaagatgggccagtt U58996 Homo sapiens testis calpastatin mRNA, complete cds. cggaagcgggccacaatgaccctgca U59057 Human beta-A4 crystallin (CRYBA4) mRNA, complete cds. aggaaagcttgaaaaatgaagacatt U59111 Human dermatan sulfate proteoglycan 3 (DSPG3) mRNA, complete cds. gcggtgcagggtaacatggcggatgc U59151 Human Cbf5p homolog (CBF5) mRNA, complete cds. gcccgcgccgtcaccatgagccaggc U59167 Human desmin mRNA, complete cds. aatagaagaggcatcatgctgaagag U59185 Human putative monocarboxylate transporter (MCT) mRNA, complete ttgcataagaccaggatgtctctgaa U59209 Homo sapiens C19steroid specific UDP-glucuronosyltransferase mRNA, gtgtctccggaggccatgggctaccc U59227 Human ectodermal dysplasia protein (EDA) gene, partial cds. atgtctccggaggccatgggctaccc U59228 Human ectodermal dysplasia protein (EDA) mRNA, complete cds. gccagacccactgcgatgagacagca U59269 Human hyaluronan synthase mRNA, complete cds. ttctagtcggacaaaatgcagccgag U59288 Human H-cadherin mRNA, complete cds. ttctagtcggacaaaatgcagccgag U59289 Human H-cadherin mRNA, complete cds. aggcctcacccagcgatgcagaaagc U59298 Human hox homeobox transcription factor (HOXB3) mRNA, complete cds. cgtcagcagcagaggatgccccaggc U59299 Homo sapiens putative monocarboxylate transporter MCT mRNA, gtgaagtttttcaacatgagtggcct U59302 Human steroid receptor coactivator-1 F-SRC-1 mRNA, complete cds. gaaatcgaagcaaacatgtctggaga U59305 Human ser-thr protein kinase PK428 mRNA, complete cds. agctccctcagcaccatgtaccgagc U59309 Human fumarase precursor (FH) mRNA, nuclear gene encoding ctacccggaggcaccatgagcgtgga U59323 Human homolog of yeast UPF1 (HUPF1) mRNA, complete cds. gaaagttatcttacaatgaaaattac U59325 Human cadherin-14 mRNA, complete cds. actagtgctgtcattatgaatgtgac U59423 Human Smad1 mRNA, complete cds. tacaatcctgacacaatggaagtttc U59431 Human truncated pancreatic polypeptide receptor PP2 mRNA, complete ggtggtagtaggaagatgtcgggcga U59435 Human cell cycle protein p38-2G4 homolog (hG4-1) mRNA, complete ccgtagttgtcccaaatggagctgga U59629 Homo sapiens transcription factor LZIP-alpha gene, complete cds. tgccgtcttctcgccatgggctccgg U59632 Homo sapiens H5 mRNA, partial cds; and platelet glycoprotein Ib